answersLogoWhite

0

There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon.

If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine.

Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more)

The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.

User Avatar

Wiki User

∙ 15y ago

What else can I help you with?

Related Questions

Is nucleic acid used for building cell parts?

In a sense rRNA, tRNA, and mRNA are all used in the translation of the genetic code to make proteins which are most of what a cell is. But in general, nucleic acids just contain the genetic blueprints of a cell.


What do it means When biologists speak of a universal genetic code they are referring to the fact that in nearly all organisms?

When biologists speak of a universal genetic code, they are referring to the fact that the same genetic code is used by almost all living organisms to translate DNA or RNA sequences into proteins. This universal genetic code is the set of rules by which nucleotide triplets (codons) are translated into amino acids.


What is the genetic code on the template strand?

The genetic code on the template strand is used to make a complementary mRNA strand during transcription. It follows the rules of base pairing, where adenine pairs with uracil and cytosine pairs with guanine. This process helps in the synthesis of proteins during translation.


What type of genetic molecule is used by viruses to make viral proteins?

Messenger RNAMessenger RNA


How many letters in the code for proteins and what are they called?

The genetic code for proteins is composed of three-letter sequences known as codons. There are a total of 64 possible codons, which correspond to the 20 amino acids used to build proteins, as well as specific start and stop signals.


What part of nucleic acid allows it to be used to form a code?

The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.


What part of a nucleic acid allows it to be used to form code?

The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.


What part of a nucleic acid allows to be used to form a code?

The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.


Why can DNA in one organism be used to make the same protein in another organism?

The Genetic Code is Universal.


What takes advantage of repeated DNA sequences that do not code for proteins?

Repeated DNA sequences that do not code for proteins can be used for a variety of purposes, such as regulating gene expression, building centromeres and telomeres, and playing a role in genetic recombination and chromosomal structure. They can also be used as genetic markers for mapping and identifying specific regions of the genome.


Hargovind khurana is credited for which discovery?

Hargobind Khorana is credited with deciphering the genetic code and showing how the order of nucleotides in nucleic acids governs the synthesis of proteins. This work ultimately led to breakthroughs in DNA research and our understanding of how genetic information is used by cells.


Why do cells use a code in the gene for?

Cells use a code in genes to determine the sequence of amino acids in proteins. This genetic code is used during protein synthesis to convert the sequence of nucleotides in DNA/RNA into the sequence of amino acids that make up proteins. This process is essential for determining the structure and function of proteins, which are crucial for various cellular processes.