answersLogoWhite

0

A comorbidity is a disease or condition that coexists with a primary disease but also stands on it's own as a specific disease. For example, someone can have hypertension (high blood pressure) and not have Diabetes. But on the other hand, someone with diabetes very often has hypertension too. So hypertension is a common comorbidity of diabetes. Other common comorbidities of diabetes are hyperlipidemia, cardiovascular disease, kidney disease, nonalcoholic fatty liver disease, and obesity.

User Avatar

Wiki User

16y ago

What else can I help you with?

Continue Learning about Biology

What is SA disorder in psychiatric?

Somatic symptom disorder (SSD) is a psychiatric condition in which a person experiences physical symptoms that are distressing or disruptive to their daily life, but no underlying medical cause can be found. Patients with SSD often become preoccupied with their symptoms and may have difficulty accepting reassurance that their symptoms are not due to a medical condition. Treatment typically involves a combination of therapy and medication.


What is huntingtons disorder?

Huntington's disease is a genetic disorder that causes the progressive breakdown of nerve cells in the brain. It leads to various physical and mental symptoms, including involuntary movements, cognitive impairment, and psychiatric issues. There is currently no cure for Huntington's disease.


What is the most common psychiatric disorder seen in medical offices?

Depression is one of the most common psychiatric disorders seen in medical offices. Symptoms include persistent feelings of sadness, loss of interest in daily activities, changes in appetite or sleep patterns, and difficulty concentrating. Treatment may involve therapy, medication, or a combination of both.


What is major depressive disorder?

Major depressive disorder is a mental health condition characterized by persistent feelings of sadness, loss of interest or pleasure in activities, changes in appetite or sleep, low energy, difficulty concentrating, and thoughts of death or suicide. It can significantly impact a person's daily functioning and quality of life. Treatment often involves a combination of therapy, medication, and lifestyle changes.


Who publishes the official listing of mental disorders for the US?

The official listing of mental disorders for the US is published by the American Psychiatric Association (APA) in the Diagnostic and Statistical Manual of Mental Disorders (DSM).

Related Questions

What is psychiatric morbidity?

it simply means psychiatric illness, that mental illnessMorbidity means the occurring or existence of a disease; more commonly used to describe two illnesses being comorbid such as anxiety is often comorbid with depression. read more about cormorbidity at http://psychiatristscottsdale.com


Is epilepsy a psychiatric disorder?

No. It is the neurological disorder.


What is Comorbid Insomnia?

Comorbid insomnia refers to sleep disturbances that occur alongside other medical or psychiatric conditions, such as depression, anxiety, or chronic pain. This type of insomnia complicates the treatment of the primary condition, as the lack of restorative sleep can exacerbate symptoms and hinder recovery. Effective management often requires addressing both the insomnia and the underlying disorder to improve overall health and well-being.


What is hysterical conversion reaction?

It is a psychiatric disorder


What is schizo effective disorder?

Psychiatric disorders.


What psychiatric disorders are associated with marijuana use?

Marijuana has been linked to the onset or worsening of certain psychiatric conditions, including panic disorder, schizophrenia, and depersonalization disorder.


What are the three types of sleep disorder?

DyssomniasParasomniasMedical or Psychiatric


Is borderline personality disorder a psychiatric illness?

YES it is


Do Serial Cheaters have any psychiatric disorder?

No they don't.


Is a psychological disorder in which individuals cycle through manic phases and periods of depression?

Bipolar I is a psychiatric disorder not a psychological disorder.


What is the name of an eating disorder marked by not eating enough food?

Anorexia. This is a psychiatric disorder called anorexia.


How common is conversion disorder?

The prevalence of conversion disorder is 5%-14% of general hospitalized patients, 1%-3% of patients referred to outpatient psychiatric clinics, and 5%-25% of psychiatric outpatients.

Trending Questions
What are the causes of fatty liver disease? Which cell types have the highest concentration of mitochondria? What do you do at home when someone has broken there bone? Why do vampires live for so long? How can one identify bug eggs? What system of specialization in a multicellular organism such as human with a bacteria cell? 3 What happens to an enzyme when it is exposed to extreme temperatures? Can you explain the process of crossing over during genetic recombination? Complex transport tubes which move water nutrients and sugar throughout some plants belongs to what level of organization? How long do ladybugs stay in their pupa stage? Why is proper microscope technique important for studying Anatomy and Physiology? What is the function of cartilage in a joint? When a sex cell divides in mitosis what is the result? What organelle do you think would be numerous inside the cells of your mouth that break down food? How does the process of restriction enzyme cutting contribute to the manipulation of DNA sequences in genetic engineering? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? The frequency of crossing over between any two linked genes is? Why is it advantageous for the antheridia and archegonia to be located on the underside of the prothallus? 3 Why do the pigments become separated during the development of the chromatogram? What are the four ecosystem types or biomes that are affected by your ecological footprint?