0
What else can I help you with?
What is genetic marker CATTG indicate?
The genetic marker CATTG could indicate a specific sequence of DNA that serves as a reference point to locate genes or genetic variations on a chromosome. It is commonly used in genetic studies to track inheritance patterns, identify genetic diseases, or analyze population diversity. Further analysis of this genetic marker would be needed to determine its specific significance in a given context.
What is the specific expressed sequence of DNA that codes for a protein in this genetic sequence?
The specific expressed sequence of DNA that codes for a protein in this genetic sequence is called a gene.
What is the purpose of the marker in gel electrophoresis?
The purpose of the marker in gel electrophoresis is to help determine the size of DNA fragments by providing known reference points for comparison.
What is the term that describes the sequence of DNA that a restriction enzyme finds and cuts?
Template Sequence
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is genetic marker CATTG indicate?
The genetic marker CATTG could indicate a specific sequence of DNA that serves as a reference point to locate genes or genetic variations on a chromosome. It is commonly used in genetic studies to track inheritance patterns, identify genetic diseases, or analyze population diversity. Further analysis of this genetic marker would be needed to determine its specific significance in a given context.
What are adjectives for marker?
some adjectives for marker could be: blue marker, red marker, black marker
What type of molecule is used as a marker to help similar cell recognize each other?
A carbohydrate is used to help mark cells. This carbohydrate sequence is unique for those cells.
What does a data marker does?
data marker
What does a data marker do?
data marker
What is micro satellite marker?
Microsatellites (sometimes referred to as a variable number of tandem repeats or VNTRs) are short segments of DNA that have a repeated sequence such as CACACACA, and they tend to occur in non-coding DNA
What is a felt maker called?
A felt marker is simply called a marker or felt marker.
What is a dependent marker word?
With is not a dependent marker.
Where is mile marker 26?
Halfway between mile marker 25 and mile marker 27.
You see a white marker with an Orange circle and black lettering. What does this marker tell you?
This is a non-lateral marker. It can indicate a controlled area, such as no wake. It can be an informational marker, a "keep out" marker, or a warning marker (Dam, Rock, etc)
What is the birth name of Harry Marker?
Harry Marker's birth name is William Harry Marker Jr..
When you drag a hanging indent marker does the left indent marker move with it?
When moving the hanging indent marker the left indent marker moves as well
