0
What else can I help you with?
What is the name of the enzyme that match the DNA bases?
DNA polymerase matches the bases on the parent strand.
What does adenine match with?
In DNA, adenine pairs with thymine. In RNA, adenine pairs with uracil.
Who would be an exact match of your DNA?
No one else in the world has the exact same DNA as me. While I share 99.9% of my DNA with other humans, the unique combination of genetic information in each of my cells is what makes me one of a kind.
What controls which DNA is amplified in PCR?
In PCR, the primers used to identify the target sequence on the DNA template determine which DNA is amplified. The primers are designed to match specific regions flanking the target sequence, allowing them to bind and initiate DNA synthesis. This specificity ensures that only the desired DNA fragment is amplified.
What method of preparing DNA for forensic analysis?
Forensic DNA analysis typically involves extracting DNA from a sample, quantifying it, amplifying specific regions using PCR, and then analyzing the resulting DNA profile using techniques like capillary electrophoresis. The extracted DNA is compared to known reference samples to determine a match or exclusion.
Which relationships has the closest DNA match?
Identical twins have the closest DNA match, as they share virtually all of their DNA. Siblings, on the other hand, share about 50% of their DNA. Parents and children also have a close DNA match, with children inheriting 50% of their DNA from each parent.
What does it mean when the swab taken from you matches your DNA and the swab taken from the alleged victim matches the victim's DNA?
A swab taken from you would contain your DNA and thus match your DNA. A swab taken from the alleged victim would contain the victim's DNA and thus match the victim's DNA. What would be shocking is if the swab taken from you didn't match your DNA, or the victim's swab didn't match their DNA. Therefor, it means that you are you, and the alleged victim is the alleged victim.
Which animal DNA mach with human?
The chimpanzees have 98% match with our DNA
When brothers marry sisters how close will they children's DNA be?
When brothers marry sisters their children's DNA will be closer that that of regular first cousins, but not as close as that of siblings.
How can one determine whether a DNA match is maternal or paternal?
To determine if a DNA match is maternal or paternal, one can look at the specific locations on the chromosomes where the match occurs. By comparing the shared segments of DNA with known genetic markers from the mother and father, it is possible to determine whether the match is on the maternal or paternal side.
Does match to crime scene DNA mean the person is guilty?
Not necessarily DNA match could mean the person was there before but it does not necessarily mean they were part of the crime
Do fathers match with their children's DNA?
Yes, fathers share some DNA with their children. Through a process called genetic recombination, parents pass on a combination of their DNA to their children. This DNA sharing is what determines similarities between a father and their child's genetic makeup.
Is there a closer DNA match than a chimp?
A banana.
Do DNA of the siblings born from the same parents match?
DNA of siblings are not complete matches of each other but show some similarity and common banding patterns. In case of identical twins, however, the DNA is a perfect match.
Can multiple DNA samples from the same individual match?
Yes, they will match to each sample from the same person.
What would match the DNA strand TCCGAACGTC?
The complementary DNA strand to TCCGAACGTC is AGGCTTGCAA. This is because adenine pairs with thymine and cytosine pairs with guanine in DNA.
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
