answersLogoWhite

0

The DNA strand, AGGCTTGCAG.

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

What strand of DNA would be prod from the template strand of DNA shown below?

The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.


DNA strand that would replicate tcgagaatctcgatt?

The complimentary DNA strand would be AGCTCTTAGAGCTAA.


What strand of DNA would be would be produced from the template strand of DNA shown?

Ttg ga


What bases would match up to form a matching DNA strand from this pattern?

A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.


When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?

TAGC.


What complementary strand of DNA would be produced from the DNA strand cgt ta?

The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.


Could DNA be amplified with only one primer?

No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.


If you were to stretch the DNA from a cell out, how long would the strand be?

If you were to stretch the DNA from a cell out, the strand would be about 6 feet long.


Which strand would be the template for the leading strand?

The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.


What strand of DNA of would be produced from the template strand of DNA?

AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.


In this strand of DNA was used that would be the complementary DNA Produced?

To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.


If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?

The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.