Subjects>Science>Chemistry

Chemical formula for aluminum sulfide

Anonymous

∙ 14y ago

Updated: 5/21/2024

S2Ur5 NO this is wrong! There isn't even an element that is Ur wow!

The answer is Al2S3

Wiki User

∙ 16y ago

What else can I help you with?

Continue Learning about Chemistry

Chemical symbol for aluminum sulfide?

The chemical formula for aluminum sulfide is Al2S3.

What is the formula for aluminum sulfide pentahydrate?

Chemical formula: Al2S3.(H2O)5 or Al2S3.5H2O

What is the formula unit of aluminum sulfide?

The chemical formula for aluminium sulfide is Al2S3.

What is the chemical formula for germanium sulfide?

The chemical formula for germanium sulfide is GeS.

What is chemical formula for hydrogen sulfide?

The chemical formula for hydrogen sulfide is H2S.

Chemical symbol for aluminum sulfide?

The chemical formula for aluminum sulfide is Al2S3.

What is the formula for aluminum sulfide pentahydrate?

Chemical formula: Al2S3.(H2O)5 or Al2S3.5H2O

What is the formula unit of aluminum sulfide?

The chemical formula for aluminium sulfide is Al2S3.

The solids aluminum and sulfur react to produce aluminum sulfide?

The reaction between aluminum and sulfur produces aluminum sulfide, which is a chemical compound with the formula Al2S3. This is a chemical reaction that involves the exchange of atoms between aluminum and sulfur to form a new compound. Aluminum sulfide is a solid compound that is often used in various industrial applications.

Mercurous sulfide- chemical formula?

The chemical formula for mercurous sulfide is Hg2S.

What is the chemical formula for germanium sulfide?

The chemical formula for germanium sulfide is GeS.

What is chemical formula for hydrogen sulfide?

The chemical formula for hydrogen sulfide is H2S.

What is the formula for a compound formed from the elements Al and S?

Al and S combine to form aluminum sulfide, Al2S3

What is the chemical formula copper sulfide?

Copper(I) sulfide is Cu2S Copper(II) sulfide is CuS

What is the formula for aurous sulfide?

The chemical formula of gold(III) sulfide is Au2S3.

What do you get Aluminium metal reacts with solid sulfur to produce solid aluminium sulfide?

When aluminum metal reacts with solid sulfur, the result is the formation of solid aluminum sulfide. This chemical reaction is a synthesis reaction where aluminum and sulfur combine to form a new compound, aluminum sulfide, with the formula Al2S3.

What is the correct formula for aluminum sulfides?

Al2S3

Trending Questions

Is rusting a chemical or physical property? What are the potential health implications of consuming a combination of coke, milk, and other dairy products together? What is the definition of metal scientifically? Formation of choloform is endothermic or exothermic reaction? How can one determine the formula of a compound? What substance has a boiling point of 78 degrees celsius? What is the Name compound of Al3 OH-1? What is the bonding in a metal such as potassium? Calculate the approximate temperature of a 0.50 mol sample of gas at 750 mm Hg and a volume of 12 L? What is the volume of 7.92g of N2 at SATP? How do you balance cu plus hno3 ----- cuno32 plus h2o plus no? What color you can mix to make color green? A hazard of methyl orange? Is radiation a solid liquid or gas? What are differences between photo synthesis and cellular respiration? What is a combining form meaning egg.? What Is the word equation for ionization of hydrochloric acid in water? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? What is clamp use for? Do chlorine compounds change the chemical properties of pools making them more acidic?

Chemical formula for aluminum sulfide

What else can I help you with?

Chemical symbol for aluminum sulfide?

What is the formula for aluminum sulfide pentahydrate?

What is the formula unit of aluminum sulfide?

What is the chemical formula for germanium sulfide?

What is chemical formula for hydrogen sulfide?

Chemical symbol for aluminum sulfide?

What is the formula for aluminum sulfide pentahydrate?

What is the formula unit of aluminum sulfide?

The solids aluminum and sulfur react to produce aluminum sulfide?

Mercurous sulfide- chemical formula?

What is the chemical formula for germanium sulfide?

What is chemical formula for hydrogen sulfide?

What is the formula for a compound formed from the elements Al and S?

What is the chemical formula copper sulfide?

What is the formula for aurous sulfide?

What do you get Aluminium metal reacts with solid sulfur to produce solid aluminium sulfide?

What is the correct formula for aluminum sulfides?

Resources

Top Categories

Product

Company