answersLogoWhite

0

Any two of:

Mutations

Non-disjunctions during anaphase of meiosis

Polyploidy

Sexual reproduction e.g. crossing-over/recombination during meiosis

IF YOU ARE LOOKING FOR THE STUDYISLAND ANSWER IT IS

a population whose members have many different traits

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

Which statement best describes a population of organisms if cloning is the only method used to reproduce this population?

If cloning is the only method used for reproduction, then all individuals in the population will have identical genetic material. This lack of genetic diversity could potentially make the population more vulnerable to disease or environmental changes. Additionally, evolution through natural selection would be limited as there is no source of genetic variation for traits to be selected upon.


What is the ultimate source of genetic variation and the basis for the diversity of life on earth?

Mutations. These have quite a few different causes. Sexual reproduction is a "more recent source" {beginning 600 million years ago} of genetic variability. The process of sharing genetic information, coupled with the random crossing and mixing of genetic information during the creation of a new organism, leads to another source of genetic variability.


What are 4 ways in which genetic variation is created in living systems?

1. Random mating 2. a large population 3. Individuals are able to migrate to different regions 4. An absense of mutation


How does sexual reproduction affect a population's genetic variation?

It affects genetic variation, because the two parental organisms might have different alleles for each gene. For example, say a blonde eyed male and a brown eyed female reproduced, and the trait for brown eyes is dominant (Bb) and the blue eyes are recessive (bb). If they mated they would have the genotypes: Bb, and bb. Therefore, increasing variation


How is gene inheritence different between sexual and asexual reproduction?

In sexually reproducing organisms the progeny receive 1/2 genetic material from the female and 1/2 genetic material from the male and this would insure some genetic variation aside from all the other genetic variation methods. In asexual reproduction the progeny inherit 100% of the genetic material and are, to an extent, closes of the progenitor organism.


An scientific example of bottleneck effect?

(In biology) The bottleneck effect happens when the size of a population or even an entire species is suddenly reduced, with lasting effects on at least one generation. A population bottleneck may occur after an epidemic, drought, fire, hunting, or other destructive events.


What are the four major points of the theory of natural selection?

1. Overproduction - more offspring are born than survive 2. Genetic Variation - there is variation in the population 3. Struggle to Survive - organisms with suitable variations will survive and reproduce 4. Differential Reproduction - suitable variations are passed on to offspring


What are the four genetic disorders?

-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT


What is the difference between sexual reproduction and genetic variation?

There is no difference. Sexual reproduction is a source of genetic variation. Because during sexual reproduction within humans, a sperm cell and egg, each consisting of different genetic codes, combine to form a completely different DNA. Immediately, a genetic variation occurs between the parents and the offspring because of the union of the gamete cells, a sperm and egg.


How does genetic drift lead to a change in a populations gene pool?

Genetic drift reduces variation in a population through allele loss, there are 2 situations of GD: a) Bottleneck effect: number of individuals is reduced significantly by a random event b) Founder effect: few individuals are separated and establish their own population both situations result in different allele frequency representations in new populations from their previous population`s


What 2 factors determine the evolution of a species?

Two key factors that determine the evolution of a species are genetic variation and natural selection. Genetic variation provides the raw material for evolutionary change, while natural selection acts on this variation by favoring individuals with traits that increase their chances of survival and reproduction.


If a certain species has little genetic variation what could lead to its rapid extinction?

A lack of genetic variation can make a species less able to adapt to changing environmental conditions or new threats like diseases or predators. This reduced ability to adapt increases the species' vulnerability to extinction if they cannot effectively respond to these challenges.