answersLogoWhite

0

Very simply put, a gene is a region of DNA that codes for a protein DNA is composed of 4 different nucleotide bases- guanine, adenine, thymine, and cytosine. A group of three of these is called a codon. A codon codes for a particular amino acid. A protein is composed of a chain of amino acids put together in the codons are in. Therefore the genetic information is the sequence of codons and by extension the sequence of nucleotide bases.

User Avatar

Wiki User

∙ 13y ago

What else can I help you with?

Related Questions

Why is DNA shaped like a double helix?

DNA is shaped like a double helix because this structure allows it to store genetic information in a compact and stable way. The double helix shape helps protect the genetic code and allows for easy access when needed for processes like replication and protein synthesis.


What did the double helix model help explain?

The double helix model of DNA helped explain how genetic information is stored and replicated in organisms. It also provided insight into how mutations occur and how variations in genes contribute to inheritance and evolution. Additionally, the structure of DNA as a double helix helped scientists understand how proteins are made based on the genetic code.


What is the significance of the double helix molecule in the structure of DNA?

The double helix structure of DNA is significant because it allows for the molecule to store and transmit genetic information in a stable and efficient manner. The twisted ladder shape of the double helix provides a protective housing for the genetic code, ensuring that it is accurately replicated and passed on to future generations. This structure also allows for easy access to the genetic information when needed for processes such as protein synthesis.


Which organic molecule contains your genetic code?

The genetic code is contained in the molecule called DNA (deoxyribonucleic acid). DNA is a long, double-helix structure that carries the genetic instructions used in the development, functioning, growth, and reproduction of all known living organisms.


What four chemicals make up the genetic code?

Adenine, Thymine, Cytosine, and Guanine are the four chemicals that make up the genetic code in DNA. These nucleotides pair in a specific way to form the double helix structure of DNA, which carries genetic information in living organisms.


How do nitrogen bases along a gene serve as a genetic code?

Yes, it is found in pairs Adenine with Thymine and Guanine with Cytosine...they are directly across from each other (horizontally) on the DNA line ( also known as a double helix) there can be many of these on one double helix


What is a double walled structure containing the cells genetic code?

The cell membrane is a double-walled structure containing a cell's genetic code.


On what molecule is the genetic code of the cell found?

Genetic code of the cell is found in a long molecule known as DNA.


What role did Francis crick have in the discovery on dna?

Francis Crick is co-discoverer of the double helix structure of DNA, along with James Watson. He played a pivotal role in research related to sequencing the genetic code.


What did Watson and crick think DNA looked like?

Watson and Crick proposed a double helix structure for DNA, with two strands that twist around each other. Their model showed how the bases adenine, thymine, cytosine, and guanine pair up to form the genetic code. This discovery revolutionized biology and laid the foundation for understanding how genetic information is stored and passed on.


The chromosomes in the nucleus of a cell contains a code known as?

The Genetic code.DNA - Did not attack! No, really DeoxyriboNucleic acid - strands of proteins in a double-helix (2 spinning strands.) It's composed of proteins named Adenine, Thymine, Guanine and Cytosine. The code looks like this:ACCTAATCAGAATAAACCACA (and so on)the proteins attach in a line AND from one helix to the other.A - G| |T - C| |C - A| |G - Aand so on - it spins downward.


What is the DNA code best described as?

The DNA code is a set of instructions that determines the genetic makeup of all living organisms. It is composed of four nucleotide bases (adenine, thymine, cytosine, and guanine) that form a double helix structure. These bases pair up in a specific way to carry genetic information.