0
What else can I help you with?
What are the four genetic disorders?
-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT
All types and products of genetic engineering qualify as?
Gene therapy
What are five types of genetic engineering?
AnswerThe three types of genetic engineering are:Applied genetic engineering which includes cloning and transgenesis.Chemical genetic engineering which includes genes mapping, gene interaction, and genes codingAnalytical genetic engineering which includes computer mapping.
What is the origin of genetic variation?
They have extremely short generation times and large populations. They can exchange DNA with many types of prokaryotes by way of horizontal gene transfer
Types of DNA that result when genes from one organism are put into another organism using genetic engineering are called this?
free
Types of genetic drift?
There are two main types of genetic drift: population bottleneck and founder effect. Population bottleneck occurs when a population's size is drastically reduced, leading to a loss of genetic diversity. Founder effect occurs when a small group of individuals establishes a new population with limited genetic variation.
What are the two types of genetic drift?
There are two types of genetic drift, there is a the population bottle neck effect and the founder effect. The population bottle neck effect is when a population greatly decreases in size due to some random ecological event and the small population has a greater chance of genetic variation. The founder effect is a variation of the bottle neck effect in which a small portion of a larger population to branch off or get "isolated" from the larger population and have a greater chance of genetic variation. Have fun and hope this helps.
What is genic drift?
Genetic drift is change in allele frequencies due to random chance events. Two types are the Founder effect and the Bottleneck effect. The founder effect is when a subset of a population goes to a new are where there are no other of that same species. The bottleneck effect is when a large population is reduced to a small population. Genetic drift decreases variation in a population and has a greater effect on a smaller population than a larger one.
What are the main types of forces?
motion and natural selection and genetic drift.
What kinds of populations are affected by genetic drift?
Genetic drift occurs in all finite populations. However the effects of drift are more pronounced in smaller populations than in large ones. Meanwhile, even though they are more present in smaller populations, the drifting is more likely to occur in larger populations because of the larger number of different genetic combinations present. Throughout evolution of populations, genetic drifting effects all types of population sizes, though it is more likely in larger populations but more present in smaller populations.
What are two types of genetic drift?
Founder effect- isolation of few individuals from larger population; new population forms with different gene pool. Bottleneck effect- Drastic reduction of population size leading to a restrictive gene pool in wich the population must use to recover. Forms population with different gene pool.
Which of the three types of natural selection works to preserve genetic variability within the population?
stabilizing
What are the types of congenital diseases?
There are a few types of congenital diseases. The term is used for any condition that is a result of a genetic abnormality. There are ones that are sex linked and affect males more than females, and then there are the ones that affect both equally.
What are the two types of glacial drift are?
Till and stratified drift :D Did you get this from Portola MS in 6th grade workbook for Science?
Define a genetic mutation and state the types of genetic mutations?
A genetic mutation is a change in the DNA sequence that can affect an organism's traits. The types of genetic mutations include point mutations (substitution, insertion, deletion), frameshift mutations, and chromosomal mutations (deletion, duplication, inversion, translocation).
What are two variables that can affect the survival rate of birds?
by the rate of population, types, habitats, and the numbers decreasing.
What are possible reason that peruvian Indians are 100 blood type 0?
It could be that the people who first colonized Peru happened to mostly be type O (about 35% of people are), and the A and B types (which would have been very rare in the population) worked their way out over many generations. This is known as Genetic Drift, more specifically the Founder effect
