In both cases, it is rung.
Rung on a ladder and wrung for twisted.
The homophone of the step of a ladder and "twisted" is "stair." Homophones are words that sound the same but have different meanings, origins, or spellings. In this case, "step" can refer to a part of a ladder or a movement with the foot, while "stair" refers to a series of steps in a building. "Twisted" describes something that is coiled or rotated.
The homophone for "step of a ladder" and "twisted" is "rung."
Ah, what a lovely question! The homophone for a step of a ladder and twisted is "rung." Just like how we carefully climb up a ladder rung by rung, let's take each day as it comes, staying balanced and steady as we navigate life's twists and turns. Remember, mistakes are just happy accidents waiting to be turned into something beautiful.
The homophone for the step of a ladder is "steppe." A homophone is a word that sounds the same as another word but has a different meaning and often a different spelling. In this case, "step" refers to a part of a ladder or staircase, while "steppe" refers to a large area of flat unforested grassland.
Rung on a ladder and wrung for twisted.
The homophone of the step of a ladder and "twisted" is "stair." Homophones are words that sound the same but have different meanings, origins, or spellings. In this case, "step" can refer to a part of a ladder or a movement with the foot, while "stair" refers to a series of steps in a building. "Twisted" describes something that is coiled or rotated.
Rung on a ladder and wrung for twisted.
The homophone for "step of a ladder" and "twisted" is "rung."
Ah, what a lovely question! The homophone for a step of a ladder and twisted is "rung." Just like how we carefully climb up a ladder rung by rung, let's take each day as it comes, staying balanced and steady as we navigate life's twists and turns. Remember, mistakes are just happy accidents waiting to be turned into something beautiful.
Watson and Crick's Name for the twisted ladder of DNA
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
The DNA molecules resembles a twisted step ladder
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
a ladder being twisted
The rungs of a ladder are the steps. Unless it is a step ladder, then they are just steps.
Nucleotides are found along the sugar-phosphate backbone of DNA, which forms the "twisted ladder" structure of the double helix. They are the building blocks of DNA and consist of a sugar, a phosphate group, and a nitrogenous base.