answersLogoWhite

0

In both cases, it is rung.

User Avatar

Wiki User

7y ago

What else can I help you with?

Continue Learning about Linguistics

What is the homophone for the step of a ladder twisted?

Rung on a ladder and wrung for twisted.


What is the homophone of the step of a ladder and twisted?

The homophone of the step of a ladder and "twisted" is "stair." Homophones are words that sound the same but have different meanings, origins, or spellings. In this case, "step" can refer to a part of a ladder or a movement with the foot, while "stair" refers to a series of steps in a building. "Twisted" describes something that is coiled or rotated.


What is the homophone fot the step of a ladder and twisted?

The homophone for "step of a ladder" and "twisted" is "rung."


What is the homophone for a step of a ladder and twisted?

The homophone for a step of a ladder and "twisted" is "rung." A rung is a horizontal support on a ladder that you step on, while "wrung" is the past tense of the verb "wring," meaning to twist or squeeze something forcefully. The similarity in pronunciation between "rung" and "wrung" makes them homophones, despite their different meanings.


What is the homophone for the step of a ladder?

The homophone for the step of a ladder is "steppe." A homophone is a word that sounds the same as another word but has a different meaning and often a different spelling. In this case, "step" refers to a part of a ladder or staircase, while "steppe" refers to a large area of flat unforested grassland.

Related Questions

What is the homophone for the step of a ladder twisted?

Rung on a ladder and wrung for twisted.


What is the homophone of the step of a ladder and twisted?

The homophone of the step of a ladder and "twisted" is "stair." Homophones are words that sound the same but have different meanings, origins, or spellings. In this case, "step" can refer to a part of a ladder or a movement with the foot, while "stair" refers to a series of steps in a building. "Twisted" describes something that is coiled or rotated.


What is homophone the step of a ladder twisted?

Rung on a ladder and wrung for twisted.


What is the homophone fot the step of a ladder and twisted?

The homophone for "step of a ladder" and "twisted" is "rung."


What is the homophone for a step of a ladder and twisted?

The homophone for a step of a ladder and "twisted" is "rung." A rung is a horizontal support on a ladder that you step on, while "wrung" is the past tense of the verb "wring," meaning to twist or squeeze something forcefully. The similarity in pronunciation between "rung" and "wrung" makes them homophones, despite their different meanings.


What was Watson and cricks name for twisted-ladder of DNA?

Watson and Crick's Name for the twisted ladder of DNA


Why the DNA molecule is compared with a twisted ladder?

the whole DNA strand looks like a twisted ladder. the molecules are on the strand.


What general shape does this fragment of DNA resemble?

The DNA molecules resembles a twisted step ladder


What does a DNA nucleotide look like?

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT


What does the double helix resemble?

a ladder being twisted


What is another name for a ladder rung?

The rungs of a ladder are the steps. Unless it is a step ladder, then they are just steps.


Nucleotides are found were on the DNA twisted ladder?

Nucleotides are found along the sugar-phosphate backbone of DNA, which forms the "twisted ladder" structure of the double helix. They are the building blocks of DNA and consist of a sugar, a phosphate group, and a nitrogenous base.