0
Add your answer:
Earn +20 pts
Which Christmas song has first line initials w s g s u t c?
please tell
What is the leading tone of the b flat major scale?
The leading note of g minor is F#. by the way leading note means 7th note.
What do you sing if you are to sing the so-fa syllables?
If u mean what notes then so=G, fa=F
What does 6 S on Mr W's G mean?
6 strings on Mr Weedon's guitar
How do you play breaking free on piano?
F F g h u y t h f s j
How do you spell stegasaurs?
S-T-E-G-O-S-A-U-R-U-S.
How do you spell languages?
languages. L A N G U A G E S. L-A-N-G-U-A-G-E-S. (lan-goo-widge-ez)
Is sierra crisamore the prittiest girl ever?
YESSSS!!!!! SHE IS ABSOLUTELY G-E-O-R-G-E-O-U-S!!!!!!!! YESSSS!!!!! SHE IS ABSOLUTELY G-E-O-R-G-E-O-U-S!!!!!!!!
What is this unscrambled s a g i s t t a u r i?
Sagittarius
How do you spell mornings?
You spelled it correctly, unless you mean grief, m o u r n i n g s.
Where is the egr g valve on Mercedes Benz a140?
when u say 140 do u mean a 140 chass a s class if so what year and what size motor straight 6 or a v8
What is the mRNA strand for ggctatatcctgcgctatacgcta?
GGAUGCACU C binds to G and A binds to U.
How many words can you make with a e y o u g m n r s t?
Words you can make with a e y o u g m n r s t --ageamanareasatateeatgategeargogoesgonegoutguestgumgutgutsmanmanymatemaymenmoanmoneymoremorguemornmostmountmournmousemousymugmugsmustmustynastynearnestnetnutnutsnormrangratrayrestroastrougerouterugrumrungsagsatsayseatsetsoarsoresourstarstarestaystoragestorestormstormysureteateartearytoetonetonguetoretorntourtoytrimtrimstuneyeastyeomanyogurtyouyoungyouryoursa e y o u g m n r s t
How do you spell sought?
s o u g h t
What word can you make with the letters a r g u s?
ArgusSugar
What are some seven letter words with 1st letter G and 3rd letter U and 5th letter G and 7th letter S?
According to SOWPODS (the combination of Scrabble dictionaries used around the world) there are 3 words with the pattern G-U-G-S. That is, seven letter words with 1st letter G and 3rd letter U and 5th letter G and 7th letter S. In alphabetical order, they are: glurges grudges grunges
What is full form of youth?
but s eck s f g u c k
