gaugcgauccguaaucugaccau
RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
Transcription
RNA Molecules
mRNA is produced inside the nucleus of the cell after transcription has occurred.
gaugcgauccguaaucugaccau
RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
Transcription
mRNA is produced from the DNA.
RNA Molecules
RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
mRNA is produced inside the nucleus of the cell after transcription has occurred.
mRNA
In protein synthesis, transcription is when the mRNA is made using a DNA template. Transcription includes the manufacturing, splicing, and the adding of caps and tails of the mRNA. This all occurs in the nucleus of the cell. ---messenger RNA is produced.
A possible effect on an error during transcription is that a nonfunctioning protein will be produced. The protein would be made of the wrong amino acids chain will be produced (and wrong shape). The wrong protein will be produced. the wrong amino acid chain will be produced
Phonemic transcription focuses on the distinctive sounds of a language, while phonetic transcription details the actual sounds produced by a speaker. Phonemic transcription simplifies sounds into broad categories, while phonetic transcription captures specific variations in pronunciation.
Phonemic transcription focuses on the distinctive sounds in a language, while phonetic transcription details the actual sounds produced, including variations in pronunciation.