answersLogoWhite

0

What else can I help you with?

Related Questions

What base sequence would be produced through transcription ACGTAAGCT?

gaugcgauccguaaucugaccau


What is a major difference between DNA replication and transcription?

RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.


Messenger RNA is produced during the process of?

Transcription


What happen during transcription?

mRNA is produced from the DNA.


What is directly produced by the process of transcription?

RNA Molecules


What is a major difference between DNA replication DNA transcription?

RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.


Where is new mRNA produced?

mRNA is produced inside the nucleus of the cell after transcription has occurred.


What molecule is produced by RNA polymerase during transcription.?

mRNA


What is produced during transcription?

In protein synthesis, transcription is when the mRNA is made using a DNA template. Transcription includes the manufacturing, splicing, and the adding of caps and tails of the mRNA. This all occurs in the nucleus of the cell. ---messenger RNA is produced.


What is a effect on an error during transcription?

A possible effect on an error during transcription is that a nonfunctioning protein will be produced. The protein would be made of the wrong amino acids chain will be produced (and wrong shape). The wrong protein will be produced. the wrong amino acid chain will be produced


What is the difference between phonemic transcription and phonetic transcription?

Phonemic transcription focuses on the distinctive sounds of a language, while phonetic transcription details the actual sounds produced by a speaker. Phonemic transcription simplifies sounds into broad categories, while phonetic transcription captures specific variations in pronunciation.


What is the difference between phonemic and phonetic transcription?

Phonemic transcription focuses on the distinctive sounds in a language, while phonetic transcription details the actual sounds produced, including variations in pronunciation.