0
What else can I help you with?
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What does the DNA look look like?
You get a toy ladder and twist it repeatedly. You get the two spring like structure, going parallel to each other. DNA helix looks like the same.
What does DNA looks like a?
DNA has a double helix structure, resembling a twisted ladder. The sides of the ladder are made up of alternating sugar and phosphate molecules, while the rungs are formed by pairs of nucleotide bases (adenine-thymine and guanine-cytosine). The specific sequence of these bases along the DNA molecule carries genetic information.
What is the DNA in the g1 stage called What does it look like?
It looks very big, juicy, and it is throbbing
What scientist found out what DNA looks like?
The structure of DNA was elucidated by James Watson and Francis Crick in 1953.
If you un-twist a DNA molecule it looks like a?
ladder.
What molecule looks like a double helix?
DNA is shaped like a double helix.
Does every organism living thing quiere DNA?
every living thing had DNA if it didnt have DNA it wouldn't be alive or be what it looks like
What the fruit dna looks like in a microscope?
The microscope will be able to help you see the cell structure and not the dna of the fruit.
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
How was Rosalind Franklin involved in discovering the structure of DNA?
She was the first scientist to figure out what DNA looks like. It looked like a double helix or twisted ladder,
What does DNA look like from a kiwi?
After doing this in a lab it looks like see through kiwi (with no seeds).
What does the DNA look look like?
You get a toy ladder and twist it repeatedly. You get the two spring like structure, going parallel to each other. DNA helix looks like the same.
What does DNA looks like a?
DNA has a double helix structure, resembling a twisted ladder. The sides of the ladder are made up of alternating sugar and phosphate molecules, while the rungs are formed by pairs of nucleotide bases (adenine-thymine and guanine-cytosine). The specific sequence of these bases along the DNA molecule carries genetic information.
What is the DNA in the g1 stage called What does it look like?
It looks very big, juicy, and it is throbbing
What scientist found out what DNA looks like?
The structure of DNA was elucidated by James Watson and Francis Crick in 1953.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
