answersLogoWhite

0

A becomes T, U becomes A, and G becomes C.

5' TAC TTT ATT 3'

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

What is the amino acid sequence that is coded for the mRNA sequence AUG-ACG-AAA-AGA-AGG-GGA-GCC-GCU-UCC-UAA?

The amino acid sequence is: UUU-UCU-UCC-CCU-CGG-CGA-AGG-AUU.


Decode the following sequence 5-aug gug uca ggg uaa-3?

The sequence 5'-aug gug uca ggg uaa-3' is an mRNA sequence that can be translated into a protein using the genetic code. The codons translate as follows: AUG (start codon) codes for Methionine (Met), GUG codes for Valine (Val), UCA codes for Serine (Ser), GGG codes for Glycine (Gly), and UAA is a stop codon, signaling the end of translation. Therefore, this sequence encodes the peptide Met-Val-Ser-Gly.


What codon starts polypeptide synthesis?

The codons are UAA,UAG and UGA


What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.


What are the universal stop codons?

The universal stop codons are UAA, UAG, and UGA. These codons signal the termination of protein synthesis during translation in all living organisms.


What what and what are stop codons?

The start codon on a messenger RNA strand marks the start point of translation from RNA to protein. It is nearly invariably AUG (which translates to the amino acid methionine). Tip for remembering: "Are you good?" The stop codon on the other hand marks the end point of translation. It can be UAG, UAA or UGA. Tip for remembering: "You are good"/"You are awful"/"You are good and awful"


Hi can anyone help me to find the answer for this question.i am doing an exam and i need some help.. thanks which are the 3 stop codons and the start codon for protein translation?

AUG - that is the start codonStop codons are UAG, UAA UGAGood luck!


What codons stop protein synthesis?

The codons that signal the termination of protein synthesis are known as stop codons. In the genetic code, there are three stop codons: UAG, UAA, and UGA. When a ribosome encounters one of these codons during translation, it signals the end of protein synthesis and the release of the completed protein.


Which codons are the stop signals?

There are three such codons known as stop codons, which are UAA, UAG, or UGA.


Which genectic information is a cue to where one gene begins and where one ends?

The start codon (usually AUG) determines where a gene begins, initiating protein translation. The stop codon (such as UAA, UAG, or UGA) marks the end of the gene, signaling the termination of translation. These genetic signals help define the boundaries of a gene within a DNA sequence.


What are the specific sequences of nucleotides that serve as the stop and start codons in the genetic code?

The specific sequences of nucleotides that serve as the stop codons in the genetic code are UAA, UAG, and UGA. The start codon is AUG.


What is mRNA base sequence for ATT?

The DNA segment 3' ATT 5' would be transcribed to the mRNA sequence 5' UAA 3'.