answersLogoWhite

0

In RNA, the base adenine (A) pairs with uracil (U), while cytosine (C) pairs with guanine (G). In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, the key difference is the replacement of thymine in DNA with uracil in RNA.

User Avatar

AnswerBot

1w ago

What else can I help you with?

Related Questions

During DNA replication which sequence of nucleotides will bond to the sequence ACGTAT?

The RNA base sequence will be CGAUUAGGCThis answer assumes that the DNA sequence in the question is the sequence on the template strand.The way to work it out is to take the complementary base of each base in the DNA:the complement of G is Cthe complement of C is Gthe complement of A is U in RNA (T in DNA)the complement of T is AAnswer is actually (E) ATACA because if you use TATGA and do the complement, which is a=t and c=g


What is a base that forms with thymine?

DNA!! the matching strands of rna form dna..


What is reverse complement?

The reverse complement is the DNA sequence reversed and then its complementary base pairs. For example, I have a sequence: ATGGGCCT so the reverse complement would be AGGCCCAT


What is the complement of the base known as g?

Cytosine, c, is the complement to guanine, g. I remember the base pairs of DNA by "Apples in the Tree. Cars in the Garage." Adenine:Thymine. Cytosine:Guanine.


Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?

in DNA, each base pairs up with only one other base


Why can you predict the base sequences and a DNA molecule of DNA if you know the sequence of the other strand?

You can predict the base seqences of a DNA molecule if you know what one strand is, because of double Stranded DNA. Each strand matches up with a letter and repeats a pattern throught the entire DNA strand.


What nitrogenous is found in rna but not in DNA?

A nitrogenous base that is found in RNA but not DNA is uracil.


Why can you predict the base of one strand in a molecule of DNA if you know the sequence of the other strands?

in DNA, each base pairs up with only one other base


What is the complement DNA strand to gtattcttcaagagatcgg?

The complement DNA strand to "gtattcttcaagagatcgg" is "ccgatctcttgaagaatac". This is achieved by replacing each nucleotide with its complementary base: A with T, T with A, C with G, and G with C.


How many hydrogen bonds connect each base pair in DNA?

Each base pair in DNA is connected by two hydrogen bonds.


How do you find a complimentry strand of DNA?

DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.


What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?

The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.