answersLogoWhite

0

In RNA, the above code would be transcribed as:

AUGGUGCACUGACUCCUGAGGAG

This is because:

  • Adenine bonds with Uracil (In DNA, Adenine bonds with Thymine)
  • Cytosine bonds with Guanine
User Avatar

Wiki User

14y ago

What else can I help you with?

Continue Learning about Natural Sciences

What is the terminator in mRNA synthesis?

The terminator in mRNA synthesis is a specific DNA sequence that signals the end of transcription. When the RNA polymerase reaches the terminator sequence, it stops transcribing the mRNA molecule, releasing it from the DNA template.


What cause RNA polymerase to stop transcribing mRNA?

RNA polymerase stops transcribing mRNA when it encounters a termination signal in the DNA sequence, typically a specific sequence of nucleotides that signals the end of a gene. This signal can be formed by specific sequences that lead to the formation of a hairpin loop in the RNA, causing RNA polymerase to dissociate from the DNA template. Additionally, termination factors may assist in this process, ensuring that transcription is completed accurately.


What determines where on the DNA molecule transcription begins and ends?

Transcription begins at a specific DNA sequence called the promoter region, which signals the RNA polymerase enzyme where to start transcribing. Transcription ends at a specific DNA sequence called the terminator region, which signals the RNA polymerase to stop transcribing. These regions, along with other regulatory elements, help determine the initiation and termination points of transcription.


Region of DNA that indicates to an enzyme where to bind to make rna?

The region of DNA that indicates where an enzyme should bind to initiate RNA synthesis is called the promoter sequence. The promoter sequence is typically located upstream of the gene that will be transcribed into RNA and is recognized by the enzyme RNA polymerase. Once bound to the promoter, RNA polymerase can begin the process of transcribing the gene into RNA.


Is the major function of rna is to carry out the genetic instructions for protein synthesis?

Yes, RNA is involved in transferring genetic information from DNA to the ribosome for protein synthesis. It carries out the instructions encoded in DNA by transcribing them into a complementary RNA sequence, which is then translated into a functional protein.

Related Questions

What picks up information from DNA?

RNA polymerase picks up information from DNA by reading the sequence of nucleotides and transcribing it into a complementary RNA sequence during the process of transcription.


What is the terminator in mRNA synthesis?

The terminator in mRNA synthesis is a specific DNA sequence that signals the end of transcription. When the RNA polymerase reaches the terminator sequence, it stops transcribing the mRNA molecule, releasing it from the DNA template.


What cause RNA polymerase to stop transcribing mRNA?

RNA polymerase stops transcribing mRNA when it encounters a termination signal in the DNA sequence, typically a specific sequence of nucleotides that signals the end of a gene. This signal can be formed by specific sequences that lead to the formation of a hairpin loop in the RNA, causing RNA polymerase to dissociate from the DNA template. Additionally, termination factors may assist in this process, ensuring that transcription is completed accurately.


How can I improve my skills in transcribing songs accurately?

To improve your skills in transcribing songs accurately, practice listening to music closely, focus on identifying melodies and rhythms, use transcription software if needed, and seek feedback from others to refine your transcribing abilities.


How can I improve my skills in transcribing music accurately and efficiently?

To improve your skills in transcribing music accurately and efficiently, practice regularly, listen closely to the music you are transcribing, use software tools to help with notation, and study music theory to better understand the structure and patterns in music.


Who is responsible for transcribing music parts into a score?

A composer.


What are some benefits of outsourcing medical transcribing?

The main benefit when outsourcing medical transcribing is the reduced cost for the employees. Other benefits are increase in productivity and research in medicine.


What determines where on the DNA molecule transcription begins and ends?

Transcription begins at a specific DNA sequence called the promoter region, which signals the RNA polymerase enzyme where to start transcribing. Transcription ends at a specific DNA sequence called the terminator region, which signals the RNA polymerase to stop transcribing. These regions, along with other regulatory elements, help determine the initiation and termination points of transcription.


Is there a template for transcribing original DNA to base sequence of RNA?

Yes, to transcribe DNA to RNA, replace thymine (T) in DNA with uracil (U) in RNA. Simply write down the complementary RNA bases to the DNA bases following this rule to transcribe the original DNA sequence to RNA.


A lac repressor turns ff the lac genes by binding to?

A lac repressor turns off the lac genes by binding to the operator


What is the function of a Tata box in gene transcription?

The Tata box is a DNA sequence that helps to initiate the process of gene transcription by providing a binding site for transcription factors. This allows the RNA polymerase enzyme to attach to the DNA and begin transcribing the gene into messenger RNA.


How to transcribe?

Transcribing involves typing into text, notes that are recorded