0
What else can I help you with?
Is AGG a codon?
No, AGG is not a codon. Codons are three-nucleotide sequences in mRNA that code for specific amino acids during protein synthesis. AGG is a nucleotide sequence present in DNA but does not directly code for an amino acid.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What would be the stand of complementary dna produced by the strand of dna shown below cgt ata?
Gca-tat gca ta The answer is AGC CT cat gt
Will the resulting protein be affected if GUA is changed to GUU?
No, the change from GUA to GUU will not affect the resulting protein because both codons code for the amino acid Valine. This is an example of redundancy in the genetic code, where different codons can code for the same amino acid.
Four examples of codons and state the instructions they encode?
AUG - codes for the start of translation and the amino acid methionine. UAA - codes for a stop signal to terminate translation. GCA - codes for the amino acid alanine. CAG - codes for the amino acid glutamine.
What are AGG and GUU examples of?
Valine
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
Where is it believed the sounds of the Brahmin ceremonies originate?
guu guu E.T
Which export is gca EXPORT?
export obligation to export to GCA countries
Does hale like guu?
when guu first came to hale's house he though she was cute, but the next morning she was a different guu. so i guess their just friends, but i think they like each other at times.
What does 'GCA exports' mean in regards to a 'Quarterly Performance Report'?
GCA Exports
What is GCA countries?
GCA stands for General Currency Area. The list of GCA countries is all countries, excluding some rupee currency countries.
When did James Agg-Gardner die?
James Agg-Gardner died in 1928.
When was James Agg-Gardner born?
James Agg-Gardner was born in 1846.
When did Alfred John Agg die?
Alfred John Agg died in 1886.
When was Alfred John Agg born?
Alfred John Agg was born in 1830.
What does GCA stand for?
You need to Google this because there are over 26 million websites for GCA.
