0
The sequence "uaa caa gga gca ucc" does not represent any meaningful information on its own. It appears to be a random sequence of nucleotides without any context or indication of what it may represent in terms of genetic information or a specific protein. If you provide more information or context, I may be able to help you interpret it.
What else can I help you with?
What would translation of the mRNA transcript UAACAAGGAGCAUCC?
To translate the mRNA transcript UAACAAGGAGCAUCC, we first identify the corresponding amino acids using the genetic code. The sequence can be divided into codons: UAA, CAA, GGA, GCA, UCC. This translates to the amino acids: Stop (UAA), Glutamine (CAA), Glycine (GGA), Alanine (GCA), and Serine (UCC). Since UAA is a stop codon, translation would terminate at that point, resulting in a polypeptide that includes only Glutamine, Glycine, Alanine, and Serine before the stop signal.
What is the amino acid order for the following mRNA that codes for a pentapeptide that is an endorphin called leucine enkephalin AUG UAC GGU GGA UUU CUA UAA?
The amino acid order for the mRNA sequence AUG UAC GGU GGA UUU CUA corresponds to the pentapeptide Met-Tyr-Gly-Gly-Phe, which is the endorphin called leucine enkephalin.
Which codons are the stop signals?
There are three such codons known as stop codons, which are UAA, UAG, or UGA.
How do you translate this DNA 5' aug AAA uaa 3'?
The DNA sequence 5' AUG AAA UAA 3' translates to the mRNA sequence 5' AUG AAA UAA 3'. The start codon AUG codes for methionine, and the UAA codon serves as a stop codon, indicating the end of the protein-coding region.
What is mRNA base sequence for ATT?
The DNA segment 3' ATT 5' would be transcribed to the mRNA sequence 5' UAA 3'.
What would translation of the mRNA transcript UAACAAGGAGCAUCC?
To translate the mRNA transcript UAACAAGGAGCAUCC, we first identify the corresponding amino acids using the genetic code. The sequence can be divided into codons: UAA, CAA, GGA, GCA, UCC. This translates to the amino acids: Stop (UAA), Glutamine (CAA), Glycine (GGA), Alanine (GCA), and Serine (UCC). Since UAA is a stop codon, translation would terminate at that point, resulting in a polypeptide that includes only Glutamine, Glycine, Alanine, and Serine before the stop signal.
What would the translation of mRNA uua caa gga gca ucc produce?
G is paired with C, U with A orT with A, U is used in RNA and T is used in DNA.Now just replace the letters with their paired letter.C G C U A U A G C-beforeG C G A U A U C G-aftertherefore your answer is GCGAUAUCG.hope this helps :)
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What is the amino acid sequence that is coded for the mRNA sequence AUG-ACG-AAA-AGA-AGG-GGA-GCC-GCU-UCC-UAA?
The amino acid sequence is: UUU-UCU-UCC-CCU-CGG-CGA-AGG-AUU.
What is the corresponding mrna section of 3'-tgt-ggg-gtt-att-5'?
The mRNA sequence which is complementary to the DNA sequence 5' - GAC ATG GAA - 3' is:3' - CUG UAC CUU - 5'
What is the amino acid order for the following mRNA that codes for a pentapeptide that is an endorphin called leucine enkephalin AUG UAC GGU GGA UUU CUA UAA?
The amino acid order for the mRNA sequence AUG UAC GGU GGA UUU CUA corresponds to the pentapeptide Met-Tyr-Gly-Gly-Phe, which is the endorphin called leucine enkephalin.
Which codons are the stop signals?
There are three such codons known as stop codons, which are UAA, UAG, or UGA.
Four examples of codons and state the instructions they encode?
AUG - codes for the start of translation and the amino acid methionine. UAA - codes for a stop signal to terminate translation. GCA - codes for the amino acid alanine. CAG - codes for the amino acid glutamine.
What are the 3 stop codes?
uag uga uaa
How do you translate this DNA 5' aug AAA uaa 3'?
The DNA sequence 5' AUG AAA UAA 3' translates to the mRNA sequence 5' AUG AAA UAA 3'. The start codon AUG codes for methionine, and the UAA codon serves as a stop codon, indicating the end of the protein-coding region.
The stop condons in the genetic code are?
Uaa, uag, uga
What 3 codons act as termination?
uag/uaa/uga
