0
What else can I help you with?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
Is RNA a double strand of nucleic acid?
Yes it is.
What strand of DNA is complement to CCATCG?
Cytosine and Guanine are complementary. Therefore the paired strand would be GGC.
What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
If one strand of DNA has the sequence atgtc what will the sequence of the second strand be?
tacag
If the sequence of bases in a nucleic acid were AUCGA is it a strand of DNA?
No, because "U," or Uracil, is found in RNA and not DNA.
Is RNA a double strand of nucleic acid?
Yes it is.
Is RNA a single strand nucleic acid?
Yes
What sequence is the sequence of the complementary strand of DNA?
its tcaa
Difference between sense and anti sense strands of DNA?
The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.
What strand of DNA is complement to CCATCG?
Cytosine and Guanine are complementary. Therefore the paired strand would be GGC.
What is the sequence of the base os agctcag on the opposite strand?
A TG CAGATTCTCTAAG
What is the sequence of complementary strand?
TGCA
