0

Subjects>Science>Natural Sciences

What is sugar soluble in?

Anonymous

∙ 7y ago

Updated: 8/11/2023

...? Did you mean "Is sugar soluble" or "what is the solublity of sugar"? If you meant the first one, then the answer is yes. If you meant the second one, then I am not sure of the exact solubility. Please resubmit the question with beter grammar.

Wiki User

∙ 15y ago

What else can I help you with?

Continue Learning about Natural Sciences

Is sugar soluble in hot water?

Sugar is soluble i tried it in my science cass.=) Sugar is soluble i tried it in my science cass.=)

Is sugar soluble in hexane?

No, sugar is not soluble in hexane. This is because sugar is considered hydrophilic, so it will only dissolve in something that contains water.

What is mean by total sugar and total soluble sugar?

Total sugar refers to the sum of all sugars present in a sample, including both free sugars and those bound within larger molecules. Total soluble sugar specifically refers to the amount of sugars that are soluble in a given solvent, typically water. Both measurements are important indicators of the sugar content in a food or beverage product.

Why does icing sugar dissolve in water?

Only sugar is soluble in water.

What are 5 substances that are soluble?

SodiumClorineIroncalciumMagnesiumsulfuriodine

Related Questions

Is sugar mixed in water a soluble?

soluble

Is sugar soluble in hot water?

Sugar is soluble i tried it in my science cass.=) Sugar is soluble i tried it in my science cass.=)

Is sugar souble or insoluble in water?

Sugar is soluble in water, meaning it can dissolve in water to form a homogeneous solution.

Is salt and sugar insoluble in water?

Both (table) salt and sugar are soluble in water.

What are examples of soluble solids?

Example of a soluble substance would be sugar and salt, both are easily soluble in the universal solvent, water

Is salt more soluble than sugar?

Yes, sugar is more soluble in water than salt.

Is sugar suluble in water?

Yes. If it dissolves in water it is soluble. Sugar, salt, soap are all soluble. Try it.

List a substance that is soluble in water?

Sugar can substance soluble in water.

How do you use the word soluble in a sentence?

The solubility of sugar(in water) increases when the water is heated up.

Is sugar soluble in hexane?

No, sugar is not soluble in hexane. This is because sugar is considered hydrophilic, so it will only dissolve in something that contains water.

What things are soluble?

Water and Sugar

Is granulated sugar a soluble?

YES

Trending Questions

What is the relationship between CO2 and temperature? Is jupiter rocky terrestrial or a gas giant? Why did the British establish the cellular jail? When did Mount Garibaldi errupt? When many similar cells specialize to perform a certain function it is referred to as? Why does litmus turn purple? Why do wild sunflowers grow next to the highways in the desert and they don't grow anywhere else? Square inches in a square yard? Do carotene's help in the capture of sunlight during photosynthesis? Does chloroplasts trap light energy? What is the dissociation of propanoic acid (CH3CH2CO2H) in water? How Cefixime is better than amoxicillin? Do granite and gabbro have similar crystal size? What element is most difficult for living organisms to obtain? What is the latitude and longitude of Rapa? What is the mRNA strand for ggctatatcctgcgctatacgcta? What mineral is found in potassium? Why does xenon have 18 valence electrons after being a noble gas? Give two examples of chemicals that are necessary for human life? When you subtract the atomic number from the atomic mass of any element you get what?

Resources

Top Categories

Product

Company

Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.