0
What else can I help you with?
Continue Learning about Natural Sciences
What does dk in measurement mean?
"Dk" in measurement typically refers to the oxygen permeability of a material, specifically related to contact lenses. It indicates how well oxygen can pass through the material to reach the eye, which is important for maintaining eye health and comfort during lens wear. A higher Dk value is associated with better oxygen permeability.
What are 3 common catergories of lipids?
i dk
Was Ceres the first dwarf planet?
dk
What does this symbol stand for . . . .?
means sk my dk
What is the calorific value of water hyacinth?
The calorific value of water hyacinth is approximately 17-19 MJ/kg.
Related Questions
How does water droplets form in a bowl of hot water?
i dk
What could happen to Saturn if it were placed in water?
Dk prolly melt lol
Who is dk?
dk is donkey kong
Which isbetter dk or redline?
DK
What are the contents chemical Substances in the SEA water as well as in the Pure Rain Water Noraml groung water?
I DK (ha ha)
When was .dk created?
.dk was created in 1987.
Dk is the abbreviation for what country?
DK is the abbreviation for Denmark
WHAT IS DK?
DK stands for Donkey Kong. He is a big gorilla with a red tie that says "DK" on it. He is very poplular.
What body of water separates Scandinavia from Europe?
Kattegat (DK) / Kattegatt (SE)
How do papain and bromelain digest proteins?
I DK What does Dk stand for?
What is dk yarn?
dk means double knitting yarn.
Who said a heedlessheadlong hurry to hell in a handcart?
dk
Trending Questions
What is the charge on the ion of thorium?
What liquids can blind someone?
What is the name of an alcohol beginning with e?
Do wet farts stain underwear?
Do colored television emit alpha beta or gamma rays?
What does a vacule do in an animal cell?
what nervous system controls the eye pupil?
Why the wood being porous makes a strong joint?
What is the lightest element on the periodic table with no stable isotopes?
What structures filter waste products from the blood to create urine?
What is potato-herb or shrub?
Why does blue travel further than red in chromatography?
How many 12 volts batteries will give you a 1000 watts?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Who concluded the cells contain a thick jelly fluid?
What are Molecules that act as catalysts in biological systems?
What is 384400 equals to. In kilometers?
Is oil energy considered a renewable source of energy?
What is the electron configuration pattern for the oxygen atom?
Do anima l cells have a cell wall?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.