answersLogoWhite

0

The sequence code for adenine in nucleic acids is represented by the letter "A." In the context of DNA and RNA sequences, adenine pairs with thymine (in DNA) or uracil (in RNA) through hydrogen bonding. Its chemical structure consists of a purine base, which is part of the genetic code that carries information for protein synthesis and other cellular functions.

User Avatar

AnswerBot

1mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What sequence of adenine code?

The sequence of adenine code typically refers to the arrangement of adenine (A) nucleotides in a DNA or RNA strand. In DNA, adenine pairs with thymine (T), while in RNA, it pairs with uracil (U). The specific sequence of adenine and other nucleotides (cytosine, guanine, thymine/uracil) determines the genetic information encoded in the molecule. To provide a specific sequence, you would need to specify the context or the particular gene or region of interest.


What would be the equivalent code for the complimentary RNA sequence For the DNA sequence AATGTCATTGC?

To find the complementary RNA sequence for the DNA sequence AATGTCATTGC, you first replace each DNA base with its RNA complement: adenine (A) pairs with uracil (U), thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, the complementary RNA sequence for AATGTCATTGC would be UUACAGUAACG.


What part of nucleotide contains the genetic code?

strand of DNA


What determines the mRNA sequence?

The genetic code is determined by the specific sequence of four nucleotide bases that make up DNA. The bases are guanine, adenine, thymine, and cytosine.


What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?

The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.

Related Questions

What sequence of adenine code?

The sequence of adenine code typically refers to the arrangement of adenine (A) nucleotides in a DNA or RNA strand. In DNA, adenine pairs with thymine (T), while in RNA, it pairs with uracil (U). The specific sequence of adenine and other nucleotides (cytosine, guanine, thymine/uracil) determines the genetic information encoded in the molecule. To provide a specific sequence, you would need to specify the context or the particular gene or region of interest.


What is the sequence a-c-t-a-g-c-a-t-a?

Adenine-Cytosine-Thymine-Adenine-Guanine-Cytosine-Adenine-Thymine-Adenine


What is the DNA code for A-T-C-G-A?

C-G-A-T-T-A-G-G-C


What would be the equivalent code for the complimentary RNA sequence For the DNA sequence AATGTCATTGC?

To find the complementary RNA sequence for the DNA sequence AATGTCATTGC, you first replace each DNA base with its RNA complement: adenine (A) pairs with uracil (U), thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, the complementary RNA sequence for AATGTCATTGC would be UUACAGUAACG.


What part of nucleotide contains the genetic code?

strand of DNA


What determines the mRNA sequence?

The genetic code is determined by the specific sequence of four nucleotide bases that make up DNA. The bases are guanine, adenine, thymine, and cytosine.


What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?

The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.


What does complimentary sequence mean?

A complimentary sequence is a sequence of DNA or RNA that is complementary to another sequence. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). In RNA, adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).


What does the presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signify?

The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.


Does mRNA use thymine or adenine in its genetic code?

It will use adenine, but thymine will be replaced by a nitrogen base called "uracil" in mRNA


What is this pattern called - TTsrTTsr?

This pattern is called a DNA sequence and represents a segment of genetic code that contains the sequence of nucleotide bases adenine (A), thymine (T), cytosine (C), and guanine (G). Each of these letters corresponds to a different nucleotide base.


What is the genetic code on the complimentary stand?

The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.