0
A three-strand rope is strong due to its construction, where three individual strands are twisted together, creating a balanced distribution of tension and load. This design allows the rope to absorb shock and resist fraying, enhancing its durability and strength. Additionally, the twisting of the strands provides a synergistic effect, where the combination of the strands working together increases the overall tensile strength compared to a single strand of the same material. The flexibility and resilience of the rope also contribute to its ability to withstand various forces.
What else can I help you with?
Which strand would be the template for the leading strand?
The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.
What is the strand of DNA that forms during replication 5' GGTTTCTTCAAGAGA '3?
The strand of DNA that forms during replication complementary to the sequence 5' GGTTTCTTCAAGAGA 3' is 3' CCAAGAACTTCTCTC 5'. During DNA replication, the new strand is synthesized in the 5' to 3' direction, pairing adenine with thymine and cytosine with guanine. Therefore, the complementary strand would be built from the corresponding bases of the original strand.
What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.
What are leading strands?
the two strand are antiparallel and the new strand must be formed on the old(parent) strand in opposite directions one of the new strand is formed as a continuous occur in long chain in the 5'_3' directions on 3'_5' strand of dna this is called the leading strand..
Which stand of mrna would be made during transcription using the DNA straind?
During transcription, the mRNA strand is synthesized using the template DNA strand, which runs in the 3' to 5' direction. The mRNA is created in the 5' to 3' direction, meaning that RNA polymerase adds complementary RNA nucleotides to the growing strand. For example, if the DNA template strand has a sequence of 3'-ATCGTA-5', the resulting mRNA would have the sequence 5'-UAGCAU-3'.
What is the length of rope needed to make a Turks head knot?
A three strand Turk's Head needs about 2 1/2 times the length a single strand takes to simply coil around 3 times. That is, if the circumference you are going around is 10 inches, it makes a 30 inch coil and will require 75 inches of line.
What is the term for the 3' to 5' strand of DNA?
The term for the 3' to 5' strand of DNA is the "antisense strand."
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
In which direction does replication occur 3 to 5 or 5 to 3?
Replication occurs in the 5' to 3' direction. The new DNA strand is synthesized in the 5' to 3' direction, while the parental template strand acts as the template for this synthesis. This directionality allows for continuous synthesis on one strand (leading strand) and discontinuous synthesis on the other strand (lagging strand).
What are the 3 undefined terms in geometry and there each examples?
PLANE The Ceiling of a room - PlaneThe Surface of the page - PlaneThe Floor - PlaneLINEThe String on a guitar - LineA Rope - LineA Hair Strand - Line
Manual for strand master remote 3 in 1?
Programe strand master remote 3 in 1
When was Chick Strand born?
Chick Strand was born on December 3, 1931.
What would be the complementary strand of 3 acgtgctacggtacg-5?
If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'
What is the coding DNA and mrna strand for the template strand 3' a-g-g-t-t-c-a-t 5'?
The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.
Which strand would be the template for the leading strand?
The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.
What would the other strand of DNA be - g g t c g a a t?
5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand
What is the strand of DNA that forms during replication 5' GGTTTCTTCAAGAGA '3?
The strand of DNA that forms during replication complementary to the sequence 5' GGTTTCTTCAAGAGA 3' is 3' CCAAGAACTTCTCTC 5'. During DNA replication, the new strand is synthesized in the 5' to 3' direction, pairing adenine with thymine and cytosine with guanine. Therefore, the complementary strand would be built from the corresponding bases of the original strand.
