0
What else can I help you with?
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.
What would the complementary strand of DNA be for the sequence cttaggcttacca?
The complementary strand for the given DNA sequence cttaggcttacca is gaatccgaatggt. This is obtained by pairing cytosine with guanine, thymine with adenine, adenine with thymine, and guanine with cytosine.
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
In this strand of DNA was used that would be the complementary DNA Produced?
To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.
If this strand of DNA were used. what would be the complementary DNA produced?
To determine the complementary DNA strand, you would pair each nucleotide with its corresponding base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand of DNA is 5'-ATCGTA-3', the complementary strand would be 3'-TAGCAT-5'. This complementary pairing ensures that the two strands are held together by hydrogen bonds, maintaining the double helix structure of DNA.
Which strand would be the template for the leading strand?
The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.
What is the strand of DNA that forms during replication 5' GGTTTCTTCAAGAGA '3?
The strand of DNA that forms during replication complementary to the sequence 5' GGTTTCTTCAAGAGA 3' is 3' CCAAGAACTTCTCTC 5'. During DNA replication, the new strand is synthesized in the 5' to 3' direction, pairing adenine with thymine and cytosine with guanine. Therefore, the complementary strand would be built from the corresponding bases of the original strand.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
How many total hydrogen bonds would exist between the dna strand and its complementary strand 5'ACTCTAG 3'?
There would be 13 hydrogen bonds formed between the DNA strand 5'ACTCTAG 3' and its complementary strand. Each adenine forms two hydrogen bonds with thymine, and each cytosine forms three hydrogen bonds with guanine.
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?
To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.
