answersLogoWhite

0

🍎

Genetics

This section covers topics of genetics such as variation, pedigrees, Mendelian genetics and mutations.

78,458 Questions

What object did Robert Hooke describe as having a honeycomb structure?

Robert Hooke described the structure of cork as having a honeycomb appearance in his seminal work, "Micrographia," published in 1665. He observed that the cork was made up of numerous small, empty cells, which he referred to as "cells," due to their resemblance to the compartments found in a beehive. This observation was foundational in the development of cell theory in biology.

Sandpaper like structure dotted with ribosomes concerned with protein synthesis?

The structure you're describing is the rough endoplasmic reticulum (RER). It is characterized by its sandpaper-like appearance due to the numerous ribosomes attached to its surface, which play a crucial role in synthesizing proteins. These proteins are typically destined for secretion, incorporation into cellular membranes, or for use within lysosomes. The RER is essential for the proper folding and post-translational modification of these proteins.

What size should a Styrofoam ball in a cell project?

The size of a Styrofoam ball for a cell project typically depends on the scale of your model. A common choice is a 4 to 6-inch ball for an animal cell and a slightly larger one for a plant cell, around 8 inches, to accommodate additional features like the cell wall and chloroplasts. Ensure that the size allows for clear labeling and representation of the cell's organelles while fitting within your project’s space constraints.

How could a difference in a sequence of nucleotides in a gene could result in a boy being albino or having normal skin?

A difference in the sequence of nucleotides in a gene associated with melanin production can lead to variations in skin pigmentation. In the case of albinism, mutations in genes like the TYR gene can disrupt the production of tyrosinase, an enzyme essential for melanin synthesis. As a result, individuals with such mutations have reduced or absent melanin, leading to lighter skin and hair. Conversely, normal nucleotide sequences in these genes would allow for proper melanin production, resulting in typical skin pigmentation.

What are the disadvantages of the nucleic acid amplification urine tests for STDS?

Nucleic acid amplification tests (NAATs) for STDs can have several disadvantages. They may produce false-positive results, leading to unnecessary anxiety and treatment, especially in populations with low prevalence of the infection. Additionally, the tests can be expensive and require specific laboratory conditions, which may limit their accessibility. Finally, NAATs may not distinguish between active infections and past exposures, potentially complicating clinical decision-making.

What would you do if you felt AA child was given insufficient nutritious food?

If I observed that a child was given insufficient nutritious food, I would first assess the situation to understand the context, including any possible barriers the caregivers might be facing. I would then engage in a compassionate conversation with the caregivers to discuss the importance of nutrition and offer support or resources, such as information on affordable healthy food options or local food assistance programs. If necessary, I would consider reporting the situation to appropriate authorities or organizations that can help ensure the child's nutritional needs are met.

What does a normal leukocyte cell do?

A normal leukocyte, or white blood cell, plays a crucial role in the immune system by identifying and combating pathogens such as bacteria, viruses, and parasites. They help protect the body against infections and diseases by recognizing foreign substances, producing antibodies, and coordinating immune responses. Leukocytes also assist in the removal of dead or damaged cells, contributing to tissue repair and overall homeostasis. Different types of leukocytes perform specific functions, including phagocytosis, inflammation, and adaptive immunity.

How many chromosomes does a lemon hav3?

Lemons have 18 chromosomes, organized in nine pairs. This is characteristic of the lemon's diploid nature, which is typical for many plant species. The chromosome count is important for understanding the genetic makeup and breeding of lemons.

What is the nickname and function of vesicles?

Vesicles are often nicknamed "transport bubbles" due to their role in transporting materials within cells. They function to enclose various substances, such as proteins and nutrients, allowing for their movement between different organelles or to the cell membrane for secretion. This transport is crucial for maintaining cellular organization and facilitating communication within the cell.

How do infection fighting cells move around the body to get to the infected area?

Infection-fighting cells, primarily leukocytes, move through the body via the bloodstream and lymphatic system. When an infection occurs, chemical signals from damaged tissues and pathogens attract these cells to the site of infection in a process called chemotaxis. They exit the bloodstream by squeezing through the walls of blood vessels, a process known as diapedesis, allowing them to reach and combat the infection effectively.

When does meiosis 1 begin?

Meiosis I begins after the cell has completed interphase, during which the DNA is replicated. This phase initiates with prophase I, where homologous chromosomes pair up and exchange genetic material through a process called crossing over. Meiosis I then progresses through metaphase I, anaphase I, and telophase I, ultimately resulting in two haploid daughter cells.

Lupe grows pea plants in her garden. The pea plants have flowers that can be either purple or white with purple color being dominant to white color. The peas produced by Lupe's pea plants can also be?

The peas produced by Lupe's pea plants can also exhibit different traits, such as being round or wrinkled. The round shape is dominant over the wrinkled shape. Therefore, the combination of flower color and pea shape results in various possible phenotypes for the offspring, depending on the genotypes of the parent plants. Lupe can predict the inheritance patterns using a Punnett square to assess the traits of the next generation.

What is the group of people in which heredity is passed through the father?

The group of people in which heredity is passed through the father is often referred to as a patrilineal society. In such societies, lineage, inheritance, and family ties are traced through the male line, meaning that children inherit their family name and property from their fathers. This system can influence various aspects of social structure, including governance and property rights.

In rabbits there are four different versions of the gene of coat color what pattern of inheritance is this?

The inheritance of coat color in rabbits, with four different versions of the gene, exemplifies multiple alleles. This means that more than two alleles exist for a given gene, allowing for a variety of phenotypes. In this case, the different coat colors arise from the combination of these multiple alleles, illustrating the complexity of genetic inheritance beyond simple dominance and recessiveness.

How does a big piece of food get small enough to enter those cells?

A big piece of food is broken down into smaller components through the process of digestion. Enzymes in the digestive system break down complex molecules like proteins, carbohydrates, and fats into smaller units such as amino acids, sugars, and fatty acids. These smaller molecules can then be absorbed through the intestinal lining and enter the bloodstream, where they are transported to cells throughout the body for use. This breakdown process ensures that nutrients are in a form small enough to be taken up by cells effectively.

What are the small DNA fragments formed from cutting called?

The small DNA fragments formed from cutting are called "restriction fragments." These fragments are generated when enzymes known as restriction endonucleases cleave DNA at specific sequences, resulting in pieces of varying lengths. These fragments can be analyzed for various applications, including cloning, sequencing, and genetic analysis.

What are three examples of viruses that contain the genetic material RNA.?

Three examples of viruses that contain RNA as their genetic material are the influenza virus, which causes the flu; the human immunodeficiency virus (HIV), responsible for AIDS; and the coronavirus SARS-CoV-2, which leads to COVID-19. These viruses utilize RNA for replication and infection processes in host cells.

How many dead skin cells are there in the air on the London underground?

On the London Underground, it is estimated that there can be around 1,000 to 10,000 dead skin cells per cubic meter of air. This number can vary based on factors such as the time of day, passenger density, and ventilation. The underground environment, being enclosed and heavily trafficked, tends to have a higher concentration of airborne particles, including skin cells.

What type of tissue that is specialized to respond to a stimuli transmitted by motor nerve cell?

The type of tissue specialized to respond to stimuli transmitted by motor nerve cells is called muscle tissue. There are three types of muscle tissue: skeletal, cardiac, and smooth. Skeletal muscle is under voluntary control and responds to signals from motor neurons, while cardiac and smooth muscle are involuntary and respond to autonomic nervous system signals. Each type plays a crucial role in movement and various physiological functions.

What does a genes have two or more of?

Genes can have two or more alleles, which are different versions of a gene that can exist at a specific locus on a chromosome. These alleles can contribute to variations in traits among individuals. In diploid organisms, such as humans, genes typically have two alleles, one inherited from each parent. The combination of these alleles can determine the expression of specific traits.

Can you be certain of the genotype of individual 5 in the figure above Explain.?

Without the specific figure referenced, I can't provide a definitive answer regarding the genotype of individual 5. However, in general, if individual 5 has a known phenotype and the inheritance patterns of the traits in question are understood, it's possible to infer the genotype. If individual 5 is homozygous for a trait, both alleles would be the same, while heterozygosity would indicate different alleles. Genetic testing or familial relationships may also provide additional clarity on determining the genotype.

Can cells processes affect the entire biosphere?

Yes, cellular processes can significantly affect the entire biosphere. For example, photosynthesis in plants converts sunlight into energy, producing oxygen as a byproduct, which is essential for the survival of aerobic organisms. Additionally, cellular respiration in animals and microorganisms releases carbon dioxide, influencing global carbon cycles and climate. Thus, the interactions of cellular processes contribute to ecosystem health and stability on a global scale.

The sequence of events occurring in the life cycle of bacterium is listed below?

The life cycle of a bacterium typically begins with binary fission, where a single bacterium divides into two identical daughter cells. This process is preceded by the replication of the bacterium's DNA and preparation of cellular components. Following division, the new cells can enter a growth phase, where they increase in size and replicate their genetic material, or they may enter a stationary phase if resources become limited. Under favorable conditions, the cycle can repeat, leading to exponential growth of the bacterial population.

How effective is Phage Therapy?

Phage therapy, which uses bacteriophages to target and kill bacterial infections, has shown promise as an effective treatment, particularly for antibiotic-resistant infections. Clinical studies have demonstrated its potential to reduce bacterial load and improve patient outcomes, especially in cases where traditional antibiotics fail. However, the effectiveness can vary based on factors such as the specific bacteria involved, the type of phage used, and the method of administration. Ongoing research is needed to better understand its efficacy and to standardize treatment protocols.

What happens to DNA when it's cell is cancerous?

When a cell becomes cancerous, its DNA undergoes mutations that disrupt normal cell growth and regulation. These mutations can arise from various factors, including environmental influences, genetic predispositions, or errors during DNA replication. As a result, the cancerous cell may continue to divide uncontrollably, evading the body's mechanisms for apoptosis (programmed cell death) and leading to tumor formation. Ultimately, these changes contribute to the aggressive behavior of cancer cells and their ability to invade surrounding tissues.

Trending Questions
If According to Mendel's law of segregation what happens to chromosomes during meiosis? A thin flexible semipermeable barrier around the cell which regulates what enters and leaves the cell.? There are several over-the-counter eyewash products on the market Describe what would happen if they were not isotonic solutions? Does polypeptide forms a pleated sheet or a helix as its tertiary structure? Lupe grows pea plants in her garden. The pea plants have flowers that can be either purple or white with purple color being dominant to white color. The peas produced by Lupe's pea plants can also be? The layers of the epidermis where mitotic divisions occur are? Freckles are inherited from one parent by? How is equilibrium important for the life of the Cell? What is the scientific term for the appearance of elodea cells placed in a hypotonic solution? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? Which genetic disorder does an extra chromosome cause? What allows more than one type of protein to be produced from one gene? Scientists who study evolution at or below the species level are most likely? Where do hair cells go when you age? Is it possible to clone a human? Process in which one generation replaces another? How many diploid chromsomes are in a carp? How do the red blood cells deliver oxygen to the brain? The nuclei that result from meiosis contain what? What happens if a cell was inhibited during the s phase of its cycle?