0
What are the base sequence of the strand of mRNA that is complementary to this segment of DNA having the following base sequence 5'GATCACCGTAGA3' show the corresponding 3' and 5' ends?
Wiki User
∙ 6y ago
5' ttagag3'
The above is wrong.
Actually, it's 5' ttagcg3'
The a complements the t; so the t complements the a
and the g complements the c; so the c complements the g.
Wiki User
∙ 11y ago
Wiki User
∙ 13y agoThe complementary strand would be 3' taccagtca 5'
Add your answer:
Earn +20 pts
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What be would the complementary strand of DNA for the following sequence of bases?
lol i hate this question........its in meh science book
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What is the sequence of complementary strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
