0
What else can I help you with?
What RNA pairs with adenine?
The phosphate base that pairs with Adenine in RNA is Uracil. In a DNA strand Adenine would pair with Thymine.
What does the base in DNA molecule pair with?
The base on one strand pair with the base on the other strand, adenine with thymine, and cytosine with guanine, they join together by hydrogen bonds. Parent
What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
During DNA replication each strand of DNA is used as a template to produce a complementary strand of DNA. What base will attatch to location 2?
During DNA replication, the base that attaches to a specific location on the template strand depends on the base present at that location. If the base at location 2 on the template strand is adenine (A), then thymine (T) will attach to the complementary strand. Conversely, if the base at location 2 is cytosine (C), then guanine (G) will be added. The pairing follows the rules of complementary base pairing: A-T and C-G.
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
What nitrogenous base does adenine pair with in an RNA strand?
In an RNA strand, adenine (A) pairs with uracil (U).
What strand of mRNA from DNA is replaced by adenine?
It's not a strand that is replaced, but a nitrogen base, much like adenine. The pyrimidine thymine is replaced by another pyrimidine uracil.
What RNA pairs with adenine?
The phosphate base that pairs with Adenine in RNA is Uracil. In a DNA strand Adenine would pair with Thymine.
What does the base in DNA molecule pair with?
The base on one strand pair with the base on the other strand, adenine with thymine, and cytosine with guanine, they join together by hydrogen bonds. Parent
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
During DNA replication each strand of DNA is used as a template to produce a complementary strand of DNA. What base will attatch to location 2?
During DNA replication, the base that attaches to a specific location on the template strand depends on the base present at that location. If the base at location 2 on the template strand is adenine (A), then thymine (T) will attach to the complementary strand. Conversely, if the base at location 2 is cytosine (C), then guanine (G) will be added. The pairing follows the rules of complementary base pairing: A-T and C-G.
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
What bass in RNA pairs with adenine?
In RNA, the base that pairs with adenine is uracil. During the process of transcription, adenine in the DNA template strand is complemented by uracil in the newly synthesized RNA strand. This pairing is crucial for the proper encoding of genetic information. Unlike DNA, which uses thymine to pair with adenine, RNA substitutes uracil for this purpose.
What is the sequeance of the bases on the opposite strand?
The opposite strand in DNA will have bases that pair with the original strand according to the base pairing rules: adenine with thymine and cytosine with guanine. So, if the original sequence is ATCG, the opposite strand will be TAGC.
Why can you predict the base sequence of one stand in a molecule of DNA if you know the sequence of the other stand?
DNA is made up four nucleotide bases,a pentose sugar and a phosphate. The four nucleotides are adenine, guanine, cytosine and thymine. Due to the nature of these molecules they fall into two groups called purines ( adenine an guanine) and pyrimidines ( cytosine and thymine). The bases have complimentary base pairing causing the double helix shape of DNA. adenine always bonds with thymjine and guanine with cytosine. So you can predict what the base sequence of one strand the other strand will be the opposite base pairing, for example if you know that a strand is AGAACTG the complimentary strand is TCTTGAC.
