0
Base Sequence CGT ACG GCT AC WHAT WOULD BE the base sequence formed by transcription?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
How do you make a 10 codon sequence for a polypeptide?
A ten codon sequence for a polypeptide is formed when 10 codons. An example would be GGGAAACCCAGAAGGCGACGCCGGCGTNNN are found in an ammino acid linked by an amide bond.
A gene has a sequence that starts with tag cat ggc at what would the mrna base sequence formed during transciption uusing DNA dequenec?
TAG CAT and GGC would pair with UTC GTU and TTG.
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What amino acid would be produced if transcription took place from the DNA sequence CAT?
g
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What would be the base sequence for the complementary DNA formed from CGT TA?
ACGGTA
What is a nth term in a sequence?
Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!
How do you make a 10 codon sequence for a polypeptide?
A ten codon sequence for a polypeptide is formed when 10 codons. An example would be GGGAAACCCAGAAGGCGACGCCGGCGTNNN are found in an ammino acid linked by an amide bond.
A gene has a sequence that starts with tag cat ggc at what would the mrna base sequence formed during transciption uusing DNA dequenec?
TAG CAT and GGC would pair with UTC GTU and TTG.
What rna sequence is transcribed using the DNA sequence agc-tac-act?
The sequence of the RNA would be UCG-AUG-UGA.
DNA strand with old sequence CAGCAT?
the new DNA sequence would be GTCGTA, but the RNA sequence would be GUCGUA
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
How do you write an RNA sequence if given the DNA sequence?
Bases A and T link together and C and G link together. If your DNA sequence was, for example, ATCGAGT your RNA sequence would be TAGCTCA.
