0
What else can I help you with?
Guanine is a complementary base for which of these DNA nucleotides?
Guanine is a complementary base for cytosine in DNA.
What are complementary bases in DNA and RNA?
DNA Adenine with Thymine, Guanine with Cytosine RNA Adenine with Uracil, Guanine with Cytosine
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
In dna guanine pairs with?
In DNA Guanine always pairs with Cytosine (C) cytosine (C) guanine (G) thymine (T) adenine (A)
What are the complementary base pairs in DNA?
The complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).
Guanine is a complementary base for which of these DNA nucleotides?
Guanine is a complementary base for cytosine in DNA.
What is the complementary base pair of cytosine?
Guanine goes with Cytosine
What base is complementary to G?
C - cytosine
Guanine matches to what in complementary pairing?
Cytosine.
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.
What bases forms a true complementary pair?
cytosine and guanine
Which is an example of complementary pairing in DNA?
guanine pairing with cytosine
What is a complimentary base for cytosine?
The complimentary base for cytosine in DNA is guanine. In RNA, the complimentary base is uracil.
What are complementary bases in DNA and RNA?
DNA Adenine with Thymine, Guanine with Cytosine RNA Adenine with Uracil, Guanine with Cytosine
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
What four chemicals are in DNA?
A DNA strand is comprised of:thymine (T) - complementary to adenineadenine (A) - complementary to thymineguanine (G) - complementary to cytosinecytosine (C) - complementary to guanine
In dna guanine pairs with?
In DNA Guanine always pairs with Cytosine (C) cytosine (C) guanine (G) thymine (T) adenine (A)
