answersLogoWhite

0

Guanine.

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

Guanine is a complementary base for which of these DNA nucleotides?

Guanine is a complementary base for cytosine in DNA.


What is the complementary base pair of cytosine?

Guanine goes with Cytosine


What base is complementary to G?

C - cytosine


Guanine matches to what in complementary pairing?

Cytosine.


What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?

The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.


Which is an example of complementary pairing in DNA?

guanine pairing with cytosine


What bases forms a true complementary pair?

cytosine and guanine


What is a complimentary base for cytosine?

The complimentary base for cytosine in DNA is guanine. In RNA, the complimentary base is uracil.


What are complementary bases in DNA and RNA?

DNA Adenine with Thymine, Guanine with Cytosine RNA Adenine with Uracil, Guanine with Cytosine


What four chemicals are in DNA?

A DNA strand is comprised of:thymine (T) - complementary to adenineadenine (A) - complementary to thymineguanine (G) - complementary to cytosinecytosine (C) - complementary to guanine


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


In dna guanine pairs with?

In DNA Guanine always pairs with Cytosine (C) cytosine (C) guanine (G) thymine (T) adenine (A)