Guanine.
Guanine is a complementary base for cytosine in DNA.
DNA Adenine with Thymine, Guanine with Cytosine RNA Adenine with Uracil, Guanine with Cytosine
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
In DNA Guanine always pairs with Cytosine (C) cytosine (C) guanine (G) thymine (T) adenine (A)
The complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).
Guanine is a complementary base for cytosine in DNA.
Guanine goes with Cytosine
C - cytosine
Cytosine.
The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.
cytosine and guanine
guanine pairing with cytosine
The complimentary base for cytosine in DNA is guanine. In RNA, the complimentary base is uracil.
DNA Adenine with Thymine, Guanine with Cytosine RNA Adenine with Uracil, Guanine with Cytosine
A DNA strand is comprised of:thymine (T) - complementary to adenineadenine (A) - complementary to thymineguanine (G) - complementary to cytosinecytosine (C) - complementary to guanine
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
In DNA Guanine always pairs with Cytosine (C) cytosine (C) guanine (G) thymine (T) adenine (A)