0
What else can I help you with?
What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
What complentary strand of DNA would be produced from the straind of DNA shown below?
To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
What is the base sequence on the other strand?
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
In this strand of DNA was used that would be the complementary DNA Produced?
To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.
How do you calculate the tmfvalue?
The melting temperature TM, characterises the stability of the DNA hybrid formed between an oligonucleotide and its complementary strand. At TM 50% a given oligonucleotide can hybridised to its complementary strand. By: Zoya Mobeen
What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
What complentary strand of DNA would be produced from the straind of DNA shown below?
To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
What is the base sequence on the other strand?
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
In this strand of DNA was used that would be the complementary DNA Produced?
To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What would be the strand of complementary DNA produce by the strand of DNA tcg aag?
Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
F this strand of DNA was used what would be the complementary DNA produced CGA CT?
To find the complementary DNA strand for the given sequence "CGA CT," you need to pair each base with its complementary base: Cytosine (C) pairs with Guanine (G), Guanine (G) pairs with Cytosine (C), and Adenine (A) pairs with Thymine (T). Thus, the complementary DNA produced would be "GCT GA."
What would the complementary strand of DNA be for the sequence cttaggcttacca?
The complementary strand for the given DNA sequence cttaggcttacca is gaatccgaatggt. This is obtained by pairing cytosine with guanine, thymine with adenine, adenine with thymine, and guanine with cytosine.
If one strand of RNA has the sequence aattgcttacc what will the sequence of the second strand be?
It's not ACCTGGAT.I think it might be TGGACCTA.you are wrong.. it IS ACCTGGAT
