0
First, you must understand that a strand of mRNA, is the complement of one side (the left) of DNA. Basically, you take the one side of the DNA strand and complement it by using these pairs: Adenine:Uracil, Cytosine:Guanine, Thymine:Adenine.
They are all usually abbreviated by their first letter.
Second, in order to find the mRNA, you must understand the process of protein synthesis. If you know the process, then it should be clear that the mRNA is made from one side of the DNA strand during the transcription. It then moves out of the cell and into the cytoplasm to start translation.
Wiki User
∙ 13y ago
Wiki User
∙ 11y agoBecause DNA does not leave the nucleus, and protein synthesis occurs on the ribosomes in the cytoplasm and rough ER. The mRNA is able to leave the nucleus and go to the ribosomes.
Wiki User
∙ 8y agocause they both have guanine, cytosine plus I am not sure I got this right so fingers cross
Wiki User
∙ 13y agoit makes the same exact strand
Wiki User
∙ 12y agoit makes the same exact strand
Add your answer:
Earn +20 pts
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
Which strand of DNA transcribes into mRNA?
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
If DNA is described as a double helix how should mRNA be described-?
mRNA is like a single strand instead of a double strand. If DNA is like a twisted ladder, then mRNA is like a single half of that ladder, with only half the bases.
Process of synthesizing an RNA strand from a DNA template strand?
The synthesis of mRNA from DNA is called transcription.
What are the three bases on one strand of DNA or mRNA called?
codon
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
How many strand of mRNA are transcribed from the two unzipped strands of DNA?
One mRNA strand is made.
How is DNA copied and made into a mRNA?
There is no such process. DNA cannot come from RNA unless it contains reverse transcriptase. However, there is a process that makes mRNA from a DNA strand. This process is called transcription.
What is formed when reverse transcriptase is used on strand of mrna?
A strand of DNA
What is formed when reverse transcriptase is used on of strand of mrna?
A strand of DNA
What is the mRNA of the DNA strand aatcgtttaaatatattgggcccgggcccggggcgcg?
UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
The mRNA strand copied from the DNA template?
transcript
Name of the DNA strand which is copied to make mRNA?
This is typically called the template DNA, which is the anti-sense strand of DNA. The strand that is not transcribed is called the sense strand.
Transcription is the process of what?
separates the DNA strand and making a complimentary strand
What is RTase?
An enzyme called reverse transcriptase, which creates a DNA strand from an mRNA strand.
What strand of mRNA would be produced from the strand of DNA shown below apex.com?
GCT AT
