A gene contains the code that determines the structure of a protein.
The order of the nitrogen bases along a gene forms a genetic code that specifies what type of protein will be produced.
Although DNA is double stranded, during transcription the two strands are separated so that a special apparatus can read and transcribe (or copy) the template recipe (ex. ATTCCTTAGGGCTTAGAGGCCGCGTAAA), the copy is called RNA and is single stranded, then uses this copy to translate (decode) it into amino acids. Each amino acid has one or more codes, called codons, consisting of 3bp. (ex. CCT, CCC, CCA, CCG- any one of those codons in DNA will code for Proline)
A protein is made up of a Specific sequence of amino acids. The sequence and variety of amino acids will determine the structures and the function of the protein.
DNA is transcribed (copied) into messenger RNA (mRNA). The messenger RNA undergoes modifications including adding a 5' guanine cap to the 5' end, and then the addition of adenine molecules to form the polyA tail at the 3' end. The mRNA is then undergoes a maturation step where it is 'spliced', and here, the non-coding introns are cut out, and the introns are ligated together. The mature mRNA moves from the nucleus to the cytoplasm where the ribosome binds to it and begins trandslating it. It sequentially adds amino acids to a growing polypeptide chain until a protein is formed.
So in short DNA --> pre mRNA --> mature mRNA --> protein
All credit given to anonymous student
The path from DNA to polypeptide (protein) involves the transcription of mRNA by RNA polymerase and the utilization of mRNA by ribosomes as a template to string together amino acids.
Say, for instance, that a particular gene, minus stops, consists of only nine bases. The nine bases are TATCCTGTT. RNA polymerase reads and transcribes this section of DNA into a corresponding strand of mRNA (this resulting strand of mRNA would read AUAGGACAA). This strand of mRNA is then bound by a ribosome and its nucleobases are matched with their complimentary bases on transfer RNA, or tRNA. The amino acids attached to the ends of tRNA molecules, on the side opposite the anticodons that bind to the mRNA template, combine to form the final product: a polypeptide chain. The sequence for the protein that would result from the example gene would be tyrosine - proline - valine.
The genes in DNA determine the amino acid sequence of proteins. This is the primary structure of a protein, which consequently influences the overall structure of the protein.
No they are not. Proteins are synthesized as per the information present in the DNA or genes. So Genes are something which determine the phenotype or a character of an organism by making RNA and proteins.
Proteins determine how a gene is expressed. Proteins are composed of amino acids that are synthesized (put together) by RNA, and RNA is made from DNA. DNA is what you inherit from your parents--very basically, your genes are sections of DNA that code for certain proteins (that are composed of amino acids).
DNA
RNA links to worlds of DNA and proteins
DNA stores instructions for making proteins.
No they are not. Proteins are synthesized as per the information present in the DNA or genes. So Genes are something which determine the phenotype or a character of an organism by making RNA and proteins.
dna chains of proteins joined by sugar and phosphate bases are dnasequence of the proteins determine what enzymes and proteins can be synthesisedthis ultimately decides cell structure
DNA and proteins
they determine the sequence of amino acids in a protein i think
No. Genetic codes are found on DNA or RNA. These code for the creation of proteins - and all products which determine the structure and function of an organism.
Proteins determine how a gene is expressed. Proteins are composed of amino acids that are synthesized (put together) by RNA, and RNA is made from DNA. DNA is what you inherit from your parents--very basically, your genes are sections of DNA that code for certain proteins (that are composed of amino acids).
DNA actually controls the production of the proteins that determine all of the traits passed on from parents to their offspring.
Segments of an individual's DNA, called genes, code for functional products (proteins). These, in addition to the environment, determine the traits of an organism.
DNA
DNA is packaged very tight by proteins. Proteins found around the DNA supports both the structure and functions. The proteins and the DNA make up the chromosomes. Proteins and DNA in animal cells are chromatin! DNA contains information because of the DNA's structure!
DNA carries the information.Base sequence determine the protein.
proteins