0
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon.
If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine.
Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more)
The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Wiki User
∙ 13y ago
Wiki User
∙ 12y agoprocessed by the behavior and DNA
Add your answer:
Earn +20 pts
Where does cellular translation occur?
In genetic processes, translation is the process by which the genetic code in messenger RNA is used to make proteins. (from the English language word for deciphering foreign meanings.)
How are RNA and DNA used to make protein?
DNA has coded instructions for making proteins, and RNA translates the code.
How does the genetic code control the production of proteins?
DNA carries the template used to create mRNA, which is then translated by ribosomes (protein synthesis). Therefore the code carried by DNA determines the sequence of amino acids which make up proteins.
What part of nucleic acid allows it to be used to form a code?
The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.
What part of a nucleic acid allows it to be used to form code?
The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.
Is nucleic acid used for building cell parts?
In a sense rRNA, tRNA, and mRNA are all used in the translation of the genetic code to make proteins which are most of what a cell is. But in general, nucleic acids just contain the genetic blueprints of a cell.
Where does cellular translation occur?
In genetic processes, translation is the process by which the genetic code in messenger RNA is used to make proteins. (from the English language word for deciphering foreign meanings.)
How are RNA and DNA used to make protein?
DNA has coded instructions for making proteins, and RNA translates the code.
What type of genetic molecule is used by viruses to make viral proteins?
Messenger RNAMessenger RNA
How does the genetic code control the production of proteins?
DNA carries the template used to create mRNA, which is then translated by ribosomes (protein synthesis). Therefore the code carried by DNA determines the sequence of amino acids which make up proteins.
What part of a nucleic acid allows to be used to form a code?
The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.
What part of a nucleic acid allows it to be used to form a code?
The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.
What part of a nucleic acid allows it to be used to form code?
The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.
What part of nucleic acid allows it to be used to form a code?
The form of nucleic acid that allows it to be used as a code is DNA. This is because DNA is the genetic code for everyone's genetic make up.
Cells store genetic information in DNA. That genetic information is used to synthesize .?
cells store genetic information in dna. that genetic information is used to synthesize
Genetic language used to translate mRNA transcripts into proteins?
Gene
Is mRNA used to carry the genetic code from DNA to ribosomes?
mRNA carries the genetic code to a ribosome.
