0
What else can I help you with?
Related Questions
How do you move Pokemon from Pokemon Ranger to Pokemon Platinum?
You cant get Pokemon from Pokemon ranger to platinum!
Platinum is it possible to move your Pokemon from silver and blue to platinum if so how some one who really wants help quick?
It Is Impossible To Move Pokemon, From Pokemon Blue Or Pokemon Silver To Pokemon Platinum Version.
What Pokemon uses the move spore in Pokemon platinum?
shroomish!!!!!!!! you have to migrate to get on diamond, pearl and platinum
Where Do You Get Ancient Power Pokemon Platinum?
its a move your Pokemon might learn
How do you defeat Pokemon league in Pokemon Platinum?
use the move nuclearbomb
What Pokemon has the move Hypnosis in Pokemon Platinum?
lots like drowzee
Is Pokemon Whirpool the same as Pokemon Platinum?
Whirlpool is a move in pokemon. It's not a game.
Where is the move Tudor in Pokemon Platinum?
pastoria city
Pokemon platinum how do you move the phyducks?
Get the SecretPotion from Cynthia
Can Scizor learn the move fly in Pokemon platinum?
no
Is there an ar code for teaching a Pokemon to throw a pokeball as a move in Pokemon platinum?
no
How do you summon a Pokemon when not in battle on Pokemon platinum?
You can use the move sweet scent.
Trending Questions
How do you get relichant in Pokemon?
British most wanted?
How many grams is 4 cups of diced apples?
What are the differences between water erosion and water deposition?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
How does the process of newborn skull development impact overall growth and development in infants?
What causes a transaxle on my 2005 Ford Freestar to get hot?
Who kills Alison in Pretty Little Liars?
Are there any data free usage apps on iPhone?
Different Types Of Arousal in sport?
Where do toadfish live?
How can you call the people on a congregation?
How long does it take for a tree to fully be grown?
When does Suburgatory season 2 come out on DVD?
What is the mission statement for abbott labs?
What was the delorian car made of?
How much does a steinway d cost?
How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L?
How do you tell how old a terrapin is?
What is 4198 to the nearest 100?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.