0
Switzerland is a country in Europe. I don't understand what you mean by "land or land mass".
What else can I help you with?
Related Questions
What is Switzerland's land mass?
41,284km squared
Is the Switzerland inland?
no Switzerland land is not a island.
Is there oceans in Switzerland?
No, Switzerland is a land-locked country.
Is Spain Romania or Switzerland a land lock?
Switzerland
What is land area Switzerland sq km?
Switzerland has a total area of 41,284 km2 of which about 39,550 km2 is land.
What is the land of chocolates?
Switzerland
What the Switzerland countries have a coastlin?
Switzerland is a land-locked country. It does not have a coastline.
What is the geographical mass of Switzerland?
The area of Switzerland is 41,285 km2 or 15,940 square miles.
Are there dolphins in Switzerland?
No. Dolphins live in the sea, and Switzerland is a land-locked country.
How many syllables does the Switzerland have?
Switzerland has three syllables: Swi-tzer-land
What sea border Switzerland?
Switzerland is a land locked country - doers not have a coastline
Is there Christmas sea food in Switzerland?
Seafood is not very common in Switzerland because Switzerland is a land-locked country.
Trending Questions
Identify the beliefs and practices that are related to science and technology?
Which of theses was an important part of George Washington's presidency?
How much sugar is in a cookie?
What is the LCM of 27 14 and 30?
What does Frota mean in spanish?
Find out what happens when people stop being polite and start getting real what tv show was billed as the true story of seven strangers?
Do elements in the d block form ions of only one charge?
How do you replace muffler on a 1995 Chevy Corsica?
What animals are found in Edmonton?
Where is telephone area code 0187?
Which is part of a traditional plot?
Alcohol plus marijuana increases drowsiness confusion and anxiety?
What was the capital of the polish republic?
What is pertrissage?
What are some seven letter words with 1st letter C and 3rd letter I and 4th letter F and 5th letter F and 6th letter O?
Does a platypus mark or protect its territory?
Latin phrase for power over time?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
Are pens a frame or shell or both?
What temperature does pyrite melt at?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.