0
Is a newly synthesized strand half of the original stand with newly formed complimentary half?
Wiki User
∙ 12y ago
yep. the new double strand is one of the original strands and a new strand
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
Does the process of DNA replication result in a copy of the original strand of DNA?
The process of DNA replication is semi-conservative. Which means, in the new (daughter) DNA double helices that are formed, one strand belongs to the parent strand (also referred to as the template strand) and the other is a newly synthesized strand. Subsequently, every new DNA molecule that is formed as a result of the replication process has one original parent strand and one newly synthesized complimentary strand.
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
What compliments TACGTT?
The complimentary DNA strand is ----> ATGCAA
What does semi-conservative mean regard to DNA replication?
replicated DNA is made of one old strand and one new strand.
Does the process of DNA replication result in a copy of the original strand of DNA?
The process of DNA replication is semi-conservative. Which means, in the new (daughter) DNA double helices that are formed, one strand belongs to the parent strand (also referred to as the template strand) and the other is a newly synthesized strand. Subsequently, every new DNA molecule that is formed as a result of the replication process has one original parent strand and one newly synthesized complimentary strand.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
What are leading strands?
Leading strands are one of the two newly synthesized DNA strands during DNA replication. They are synthesized in a continuous manner in the 5' to 3' direction, following the replication fork. The leading strand is synthesized in the same direction as the replication fork is moving, allowing for continuous synthesis.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
What is the term for the DNA strand that acts as a pattern to the newly synthesized DNA?
template strand
What compliments TACGTT?
The complimentary DNA strand is ----> ATGCAA
What is the complimentary strand of GTA-GCA?
acg-att
