0
T-a-c-c-a-c-g-t-g--a-c-t-g-a-g-g-a-c-t-c-c-t-c what is the transcribing sequence?
Wiki User
∙ 13y ago
In RNA, the above code would be transcribed as:
AUGGUGCACUGACUCCUGAGGAG
This is because:
- Adenine bonds with Uracil (In DNA, Adenine bonds with Thymine)
- Cytosine bonds with Guanine
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Which functions are carried out by a cell's ribosomes?
Transcribing messenger RNAs to proteins.
How does transcription end?
Transcription ends once the a termination sequence is reached. The sequence depends on which polymerase is being used and if the organism is a eukaryote or prokaryote. In Eukaryotes when RNA polymerase 1 is used the termination sequence is an 18 nucleotide long sequence. For RNA polymerase 3 the termination sequence is a short sequence of Uricils but the hairpin loop is not formed as it is in prokaryotes. For RNA polymerase 2 transcription is terminated and cleavage takes place 10-35 nucleotides downstream of the AAUAA sequence. For prokaryotes, termination can occur 2 ways. Termination can occur once the termination sequence is reached or using a protein called Rho factor. For termination without Rho factor, the termination sequence is short and rich in Guanines and Cytosines followed by many Uricils in a row. A-U bonds are weaker than G-C bonds, the string of U-A bonds are easily broken and release the RNA strand Using a Rho factor, once the Terminal sequence is reached, the Rho factor binds to a sequence 50-90 bases long and unwinds the DNA from the RNA , moving towards the 3' end, releasing the RNA
DNA is the nucleic acid responsible for transcribing the genetic code?
Not exactly. DNA contains the genetic code; RNA is what transcribes it.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is a muck head screw?
In transcribing medical reports a muc screw is a multi-use compression screw. It is an acronym for a specialized compression screw.
Is there a template for transcribing original DNA to base sequence of RNA?
DNA is a template for making RNA. I hope this answers your question.
Who is responsible for transcribing music parts into a score?
A composer.
What are some benefits of outsourcing medical transcribing?
The main benefit when outsourcing medical transcribing is the reduced cost for the employees. Other benefits are increase in productivity and research in medicine.
What Enzyme is necessary in transcribing mRNA from DNA?
RNA polymerase
How to transcribe?
Transcribing involves typing into text, notes that are recorded
What enzyme is responsible for the transcribing RNA?
It would have to be RNA Polmerase -JV
Which functions are carried out by a cell's ribosomes?
Transcribing messenger RNAs to proteins.
When is the lactose operon likely to be transcribed?
whenever it's in that transcribing kind of mood
What does Damian Wayne say TT?
It's an onomatopoeia transcribing approximately a dental click
What is a transcribing agency?
A company that writes professional and official letters and such for business and court use.
What action word with the letter t for the workplace?
Some choices: talking, typing, transcribing, tallying
When transcribing it is important to?
To transcribe it EXACTLY as it was spoken without making any additions, deletions, or edits.
