0
The sequence of the nitrogenous bases, which are the 'rungs' of the DNA 'ladder' are what give DNA its specificity.
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is he process of identifying the sequence of nucleotides along a segment of DNA?
DNA sequence
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What initially determines which DNA strand is the template strand and therefore in which direction RNA polymerase ii moves along the DNA?
the specific sequence of bases along the DNA strands
What hold the side of DNA ladder together?
what holds the sides of the DNA ladder together
An enzyme that reads along a sequence of bases in DNA making a complementary sequence of nucleotide bases in RNA is?
RNA Polymerase.
What forms the side of a DNA ladder?
Phosphates and Sugars formthe sides of the DNA ladder~
What are the sides of the DNA ladder are made up of?
The DNA ladder is made of sugar and phosphates.
What is the purpose of the ladder marker DNA?
DNA passes through a gel at different speeds depending on its size. The purpose of the ladder marker of a DNA is to make the passing of DNA possible.
What is a unit of inheritance composed of a sequence of nucleotides of DNA?
It is known as a Gene. Along with its coding sequence it also possesses Start and Stop sequences.
What is an allele ladder and what is its function in DNA profiling?
it is a ladder.
What was Watson and cricks name for twisted-ladder of DNA?
Watson and Crick's Name for the twisted ladder of DNA
What makes up the sides of the DNA ladder?
Phosphate and sugar make up the sides of a DNA ladder.
