answersLogoWhite

0

Were does the jaguar cat live?

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

The Jaguar lives in South America, Mexico, and as of late, they are showing up in southern Arizona and possibly New Mexico.

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

Does a Jaguar live on land or water?

A jaguar? The cat? They live on land


What jaguar family do they live in?

they live in the cat family


What are the main differences between a jaguar and a cat?

The Jaguar is a cat.


Does the jaguar live in packs or groups?

Jaguars, like most cat species, are solitary.


When does the jaguar sleep?

Just live every other wild cat, about 15-18 hours


In what grouping is the jaguar?

A cat? Panthera Onca, or jaguar, is the world's third largest cat.


What is a jaguar's offspring?

A jaguar's offspring is called a cub.


Is the jaguar the strongest cat?

The jaguar is the strongest cat for its size, but because the tiger and lion are larger, they stronger overall.


What cat species is smaller than a jaguar?

Yes, the mountain lion is smaller than the jaguar. The jaguar is the 3rd largest of the big cats, behind the lion and the tiger. It is the largest big cat found in the Americas.


Is a jaguar a reptile?

the tiger is in the mammal family. it is also in the cat family!!


Is there a spanish word that relates to the jaguar cat?

It is "jaguar", but is pronounced "hahg-WAHR".


What is the largest cat that lives in the Amazon?

the biggest cat in the amazon is the Jaguar.

Trending Questions
Should juveniles being tried as adults? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? The point where two air masses meet is called a? How do you get seaman's book what are the requirements? How did science and technology lead to the growth of Mayan influence? What is 10 million divide by 9.856? From where is Vanessa Hudgens mother? How can you find garibaldi fish? What is the time to turn a distance of 1 degree? When was theora stephens born? Which continent are the himalaya mountains located? Where do you often find an adjective? Did Hernando De Soto ever go to school? Is Hansel and Gretel American literature? Did Kristinia Debarge go to South Pasadena High School or was she homeschooled? Is 3 days enough to have a opiate free urine sample? What do the doctors say about marijuana in your system? Is regardless a verb? ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this? What was The French courtly love song of the Middle Ages called?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.