0
What allows more than one type of protein to be produced from one gene?
Wiki User
∙ 10y ago
Alternative splicing greatly increases the number and variety of proteins encoded in the cell nucleus without increasing the size of the genome.
Wiki User
∙ 10y ago
Add your answer:
Earn +20 pts
Why do the introns have to br removed?
Introns are the non-coding parts of the gene. If you didn't remove introns, the wrong protein may be produced because they allow more than one protein to be produced from a single gene.
How can large quantities of protein be produced from a bacterial colony containing the gene of interest?
In Gene clonning copy no of gene increse and translation of each gene produce more no of protein so one can increas production of protein
The human gene for muscle protein is different from a monkey's muscle protein gene in 4 places and different from a chicken and muscle protein gene in 25 places. What does this evidence tell us?
That humans are more closely related to monkeys than to chickens.
If a specific kind of protein is not continually used by a cell the gene for that protein is?
the gene is never expressed. ^^^^ this guy is a frickin idiot. and this would more of be in the cells/ biology section. What happens is a repressor binds to the operator and turns off the gene so the protein doesn't get made. and when its needed the repressor detaches and the gene is turned back on. ( this all happens on a strand of DNA )
Why do transgenic bacteria that have the gene for human insulin produce insulin in great abundance?
It is the easiest way for this protein to be produced. The DNA encoding human insulin can be put under the control of a constituitively active promoter and transfected into bacteria, which then produce the protein with their cellular machinery.
Why do the introns have to br removed?
Introns are the non-coding parts of the gene. If you didn't remove introns, the wrong protein may be produced because they allow more than one protein to be produced from a single gene.
How can large quantities of protein be produced from a bacterial colony containing the gene of interest?
In Gene clonning copy no of gene increse and translation of each gene produce more no of protein so one can increas production of protein
The human gene for muscle protein is different from a monkey's muscle protein gene in 4 places and different from a chicken and muscle protein gene in 25 places. What does this evidence tell us?
That humans are more closely related to monkeys than to chickens.
If a specific kind of protein is not continually used by a cell the gene for that protein is?
the gene is never expressed. ^^^^ this guy is a frickin idiot. and this would more of be in the cells/ biology section. What happens is a repressor binds to the operator and turns off the gene so the protein doesn't get made. and when its needed the repressor detaches and the gene is turned back on. ( this all happens on a strand of DNA )
Why do transgenic bacteria that have the gene for human insulin produce insulin in great abundance?
It is the easiest way for this protein to be produced. The DNA encoding human insulin can be put under the control of a constituitively active promoter and transfected into bacteria, which then produce the protein with their cellular machinery.
Traits that are produced by the interaction of more than one gene are said to be?
polygenic inheritance
What would happen if a plasmid was cut at more than one site?
More gene fragments would be produced.
Why must introns be removed while the exons remain in the mRNA?
Introns are non-translated sections of a gene, i.e. they are not made into protein. The gene is stored in the chromosomes as DNA. When the corresponding protein is needed, the DNA is copied (transcribed) by RNA polymerase making a complementary copy of the gene made of RNA. This is then processed to remove the introns (the non-coding parts of the gene). It was long thought these introns hasdno use. However, there is evidence that they have a role in the processing of the RNA. In addition, introns allow more than one protein to be produced from a single gene. The RNA with the introns removed is now the messenger RNA (mRNA) which is transported out of the nucleus into the cytoplasm, where it is read by the ribosome, which produces the coded protein. See http://en.wikipedia.org/wiki/Intron
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
What is the causes of cystic fibrosis?
Cystic fibrosis is caused by a mutation on the recessive allele of the CFTR gene. It is caused by a deletion of three adenine bases, so the CFTR protein produced has 1479 amino acids instead of 1480, although only one amino acid is missing this has an effect on the tertiary structure of the protein produced. The CFTR protein normally allows Chloride ions out of the epithelial cells of the airways, producing a more negative water potential outside of the cell and so water would usually move out of the cell and flush away the mucus. Since this protein is non-functional, water remains in the cell. Therefore this produces thick, sticky and viscous mucus, that can trap pathogens and cause disease for example.
Descibe the difference between the terms allele and genes?
One gene provides the information for on specific protein for one purpose. However, there can be many different variants of this gene due to permutations in the genetic code. This can means more than one type of gene being present in the general population for just one protein, which can change the resulting product (protein). The scientific term for this is allele.
What is the role of genes in protein production in the cell?
A cell can either make more mRNAs that correspond to that gene so that more transcripts are translated at once.
