0
It codificates the aminoacid
Císteina in spanish
Wiki User
∙ 12y ago
Wiki User
∙ 11y agophenylalanine
Add your answer:
Earn +20 pts
What codon codes for amino acids phenylalanine did scientist find?
There are two codons that code for the amino acid phenylalanine: UUU and UUC.
Which three codons would code for a different amino acid sequence from that coded for by the mrna base sequence agu uca cca?
AGU and UCA both code for the amino acid serine - so do the codons AGC, UCU, UCC and UCG. CCA codes for proline - so do CCU, CCC and CCG. Therefore any codons which do not code for the sequence serine-serine-proline will be different. For example: UUC-GCU-AAU will code for a different amino acid sequence
Why does a base substitution mutation in a gene not always result in a different protein?
Substitution mutations can be silent mutations, meaning that although one of the bases has changed, the codon still codes for the same amino acid. For example - if the original DNA was changed from AAA to AAG, the codon would change from UUU to UUC. Both UUU and UUC code for the amino acid phenylalanine - so the resulting protein would be exactly the same. The mutation is therefore called 'silent' because it has no affect.
What anticodon matches the codon cuc?
The anticodon sequence would be GAG-UUC-ACG-AAG.
Amino acid sequence for ctg ggc tta aag cgc?
Due to the calculations you make using your genetic code dictionaries, you must go backwards using the third letter of codon and then second and then first. Then, you have your answer for what the amino acid sequence would be for cga gaa guc. Then you just flip cga and guc, keeping gaa in the middle.
What are the DNA codons for phenylalanine?
There are two codons that code for the amino acid phenylalanine: UUU and UUC.
What codon codes for amino acids phenylalanine did scientist find?
There are two codons that code for the amino acid phenylalanine: UUU and UUC.
Which three codons would code for a different amino acid sequence from that coded for by the mrna base sequence agu uca cca?
AGU and UCA both code for the amino acid serine - so do the codons AGC, UCU, UCC and UCG. CCA codes for proline - so do CCU, CCC and CCG. Therefore any codons which do not code for the sequence serine-serine-proline will be different. For example: UUC-GCU-AAU will code for a different amino acid sequence
What is the maximum number of amino acids that could be coded for by a sextion of mrna with the sequence guucagaacugu?
A codon is three bases long - so this section of mRNA would have 4 codons; UGA-UUC-AGU-AAC.Each codon relates to a specific amino acid (but several codons can code for the same amino acid, for example both UUU and UUC code for the amino acid Phenylalanine).Normally if you have four codons, such as this section of mRNA, the maximum number of amino acids you could have would be four. However, the first codon in this section, UGA, is actually a STOP codon. This means that when the ribosome reaches this codon, no further amino acids will be joined.This means that no amino acids could be coded for with this section of mRNA. (If the order of the codons was reversed, making the STOP codon last, then the answer would be three).
Can an amino acid be specified by more than one codon?
Yes, each amino acid has several codons that correspond to it. Please see the related link for a chart which shows this. For example, UUU and UUC both code for Phenylalanine. However, if you are asking if a codon can code for more than one amino acid, the answer is no (but there are exceptions). This means that UUU codes for Phenylalanine - not for any other amino acids. Codons are made in sets of three bases to match the anticodons in corresponding sets of three bases.
Why does a base substitution mutation in a gene not always result in a different protein?
Substitution mutations can be silent mutations, meaning that although one of the bases has changed, the codon still codes for the same amino acid. For example - if the original DNA was changed from AAA to AAG, the codon would change from UUU to UUC. Both UUU and UUC code for the amino acid phenylalanine - so the resulting protein would be exactly the same. The mutation is therefore called 'silent' because it has no affect.
What anticodon matches the codon cuc?
The anticodon sequence would be GAG-UUC-ACG-AAG.
Amino acid sequence for ctg ggc tta aag cgc?
Due to the calculations you make using your genetic code dictionaries, you must go backwards using the third letter of codon and then second and then first. Then, you have your answer for what the amino acid sequence would be for cga gaa guc. Then you just flip cga and guc, keeping gaa in the middle.
What is the protein strand created from the mrna strand cagaaguuccucucgc?
The sequence of amino acids (forming a protein) that result from the mRNA strand CAG-AAG-UUC-CUC-UCG-C would be: Glutamine-Threonine-Phenylalanine-Leucine-Serine Each codon must be three bases long - therefore the end of this mRNA sequence 'C' cannot code for an amino acid. There would also need to be a stop codon at the end to complete translation.
What strand of mrna would be produced from the strand of DNA shown below gct aag?
GCT AAG would produce the strand of mRNA of "CGA UUC" CGU AAU UGA CUG
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What would the effect on translation be of a single base pair deletion in an organism's DNA?
Assuming that the deletion occurs somewhere in the protein coding region of an organism's DNA - that is any where within it's Genome excluding introns and other non-expressed regions - : mRNA sequence (transcribed from DNA) is translated into protein using triplet - codons, meaning that three consecutive nucleotide bases code for one amino acid (a building block of the protein chain). For example: UUU CCU CAA A.... (nucleotides) codes for Phe Pro Asn ... (3 letter abbr. for amino acids). Now, if the first nucleotide gets deleted, we get: UUC CUC AAA that translates into: Phe Leu Lys . What happens is that triplets shift to the right by one nucleotide and that changes the meaning of all triplets that follow resulting in a protein with a different amino acid composition [sequence] that almost for certain has lost its intended function or even becomes damaging to the organism - these are rarely beneficial due to the following: these are called Frame-Shift mutations and you are quite right they usually have quite a deleterious effect.
