0
Any two of:
Mutations
Non-disjunctions during anaphase of meiosis
Polyploidy
Sexual reproduction e.g. crossing-over/recombination during meiosis
IF YOU ARE LOOKING FOR THE STUDYISLAND ANSWER IT IS
a population whose members have many different traits
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
What are 4 ways in which genetic variation is created in living systems?
1. Random mating 2. a large population 3. Individuals are able to migrate to different regions 4. An absense of mutation
What are the four genetic disorders?
-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT
Is it common for a population to remain in genetic equilibrium?
1) No mutations 2) No natural selection 3) No individuals in or out of a population. 4) Large population 5) Random mating It is, however, impossible for a population to achieve genetic equilibrium. There are always going to be mutations occurring from time to time.
Which source of genetic variation produces the greatest variety?
Heterozygote X HeterozygoteEg.Hh X Hh- produces HH, 2 Hh, hh = 3 different genotypesWhereas:HH X hh- produces all HhAnd HH X HH- produces all HH
What causes poor water supply?
(1) a high rate of population growth, (2) lack of investments in water supply infrastructure, and (3) the upper limit imposed by the availability of water sources.
What is the ultimate source of genetic variation and the basis for the diversity of life on earth?
Mutations. These have quite a few different causes. Sexual reproduction is a "more recent source" {beginning 600 million years ago} of genetic variability. The process of sharing genetic information, coupled with the random crossing and mixing of genetic information during the creation of a new organism, leads to another source of genetic variability.
If a certain species has little genetic variation what could lead to its rapid extinction?
Genetic bottleneck causes very little genetic variation and can cause genetic drift.
What are 4 ways in which genetic variation is created in living systems?
1. Random mating 2. a large population 3. Individuals are able to migrate to different regions 4. An absense of mutation
How is gene inheritence different between sexual and asexual reproduction?
In sexually reproducing organisms the progeny receive 1/2 genetic material from the female and 1/2 genetic material from the male and this would insure some genetic variation aside from all the other genetic variation methods. In asexual reproduction the progeny inherit 100% of the genetic material and are, to an extent, closes of the progenitor organism.
An scientific example of bottleneck effect?
(In biology) The bottleneck effect happens when the size of a population or even an entire species is suddenly reduced, with lasting effects on at least one generation. A population bottleneck may occur after an epidemic, drought, fire, hunting, or other destructive events.
What are the four major points of the theory of natural selection?
1. Overproduction - more offspring are born than survive 2. Genetic Variation - there is variation in the population 3. Struggle to Survive - organisms with suitable variations will survive and reproduce 4. Differential Reproduction - suitable variations are passed on to offspring
What are the four genetic disorders?
-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT
One consequence of genetic drift is?
Genetic drift usually only has effect on the genetic diversity of small populations of a species. Often times, genetic drift can greatly reduce the diversity of a population if a significant percent of members of the population leave by a chance event (as opposed to natural selection.) This means that their alleles for various genes leave with them. Genetic drift does not always effect genetic diversity. Most of the time, it is the allele frequency that is affected by genetic drift. For example, if there are 60 long-finned bass and 40 short-finned bass living in a pond, the gene frequency ratio is 3:2. If 25 short-finned are fished out, the allele frequency is now 4:1. If all or most of the members of a population carrying a specific gene were removed from the population because of genetic drift, that would effect the genetic diversity.
How does genetic drift lead to a change in a populations gene pool?
Genetic drift reduces variation in a population through allele loss, there are 2 situations of GD: a) Bottleneck effect: number of individuals is reduced significantly by a random event b) Founder effect: few individuals are separated and establish their own population both situations result in different allele frequency representations in new populations from their previous population`s
What are the 3 ingredients for natural selection to occur?
Genetic variation that can be acted on by environmental pressure. Reproductive population that results in more organisms than can be supported by the ecosystem resulting in competition for limited resources, the ability of the organism to transmit genetic information to the next generation.
How does meiosis introduce genetic variation into offspring?
1 by crossing over in prophase I , 2 by independent assoartment and 3 by mutations in s phase .1 by crossing over in prophase I , 2 by independent assoartment and 3 by mutations in s phase .Meiosis produces variation in gametes by crossing over & independent assortment also called reshuffling of genetic material . Such gametes after fertilization produce offspring with different characters .
How does sexual reproduction affect a population's genetic variation?
It affects genetic variation, because the two parental organisms might have different alleles for each gene. For example, say a blonde eyed male and a brown eyed female reproduced, and the trait for brown eyes is dominant (Bb) and the blue eyes are recessive (bb). If they mated they would have the genotypes: Bb, and bb. Therefore, increasing variation
