0
What are some of the harmful and positive effects of genetic mutations?
Carlsonbree1
Genetic mutation have a few effects to look out for. First of all, a genetically mutated body part or organ will not function as long as an average body part or organ. However, in some cases, these mutations are helpful for those whom could otherwise use them as prosthetic organs or body parts. In addition, people whom have a genetic mutation are sometimes given a monthly check if their mutation prohibits them from every day tasks.
Wiki User
∙ 10y ago
Wiki User
∙ 12y agobuy fallout 3 it will answer your question
Add your answer:
Earn +20 pts
What causes genetic mutations?
Mutations are changes in the nucleotide sequences in a genome. Most often, these minor mistaks are corrected by in-built repair mechanisms and many mutations go unnoticed an are not harmful. Harmful mutations cause diseases in many cases. There are several factors that promote the formation of mutations. These factors are called mutagenic agents. Mutagenic agents are divided into: chemical and physical mutagens. UV radiation is an example of a physical mutagen and Nitrous acid is an expample of a chemical mutagen
Harmful effects of technology?
chubaekek
How can you minimize the harmful effects of a typhoon?
How can you help minimize the harmful effect of a typhoon
Are Changes in the genetic make-up are normally helpful or harmful?
emmilee
What are the four genetic disorders?
-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT
Are genetic mutations always harmful to the individual?
Genetic mutations are not always harmful to the individual. A few may be beneficial.
Why are some mutation not harmful?
Some mutations can be deadly, harmful, or have no effect. Correct, not all mutations are harmful. Some mutations could even have a positive effect and help the creature adapt.
What kind of mutations do you think would be harmful to an organism?
The majority of mutations that organisms get are harmful or neutral. Cancer is an example of a harmful mutation. So are certain genetic diseases and deformities, like an extra set of limbs.
What genetic mutations can cause?
A genetic mutation can cause a variation, which may be harmless, or may be harmful, depending on where on the DNA molecule it occurs.
Why do mutations tend to be harmful instead of helpful?
Not all mutations are harmful. The improvements in creatures through evolution are from beneficial mutations. The beneficial mutations increase the creature's chance of survival and passing along those new beneficial genes to its offspring.
What are the various kinds of mutations?
Mutations differ and change according to many factors: 1- Site of occurrence: -Genetic mutations -Chromosomal mutations 2- The inheritance: -Somatic mutations -Gamete mutations 3- The origin: -Spontaneous (natural) mutations -Induced mutations 4- The harmful OR useful effects: -Undesirable mutations -Desirable mutations
One of the most powerful agents of genetic change?
is mutation. Mutations can occur spontaneously, through errors in DNA replication, or can be induced by environmental factors such as radiation or chemical exposure. These changes in DNA sequence can lead to alterations in the genetic code and can have a wide range of effects, from beneficial adaptations to harmful disorders.
Are there any harmful effects of super beta prostates?
I did some research, and there do not appear to be any harmful effects of Super Beta Prostates. It is a natural supplemant that has shown either positive effects or no effects at all.
How can mutations be detrimental to an organism?
They are not always harmful. in fact, often they are not. There are many different mutations, but genetic mutations can occur and be harmful to humans. it is important to understand that Genes are not there to cause diseases or be harmful. if a gene is transcribed incorrectly or copied incorrectly, this can result in a single letter of DNA ommitted in a chain. This is harmful because the different parts of the body that transcribe DNA or RNA will not be able to transcribe it as it was intended to be transcribed.
How does variation help or hurt an organism?
Mutations, or variations in genetic code that alter the structure of an organism, can in theory help a creature by allowing adaptation to its changing surrounding. However, genetic code can be rather delicate; many learning disorders are attributed to common, malignant mutations in genetic code.
When is a mutation harmful?
Not all mutations are harmful. A mutation the give the organism antibiotic resistance, for example, is quite helpful. A different mutation that causes a necessary protein to misfold may result in death. In general mutations that affect proteins that are necessary for life will result in the death of the organism. One such mutation is in the protein p53 which is necessary to prevent a cell from growing uncontrollable (cancer). A mutation in p53 could result in a cell with damaged DNA to reproduce - this is what we call cancer.
The mutation that results in sickle cell anemia produces effects that are?
Both harmful and positive
