Tags English Language

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Social Studies>Linguistics

What are the homophones for the step of a ladder and twisted?

Updated: 5/4/2024

Wiki User

∙ 6y ago

Best Answer

In both cases, it is rung.

Wiki User

∙ 6y ago

This answer is:

More answers

∙ 1w ago

The homophones for the step of a ladder are "stair" or "stare." The homophones for "twisted" are "twist" and "twixt."

This answer is:

Add your answer:

Earn +20 pts

Q: What are the homophones for the step of a ladder and twisted?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Linguistics

What is the homophone for the step of a ladder twisted?

Rung on a ladder and wrung for twisted.

What is the homophone fot the step of a ladder and twisted?

The homophone for "step of a ladder" and "twisted" is "rung."

What is the homophone of the step of a ladder and twisted?

The homophone of "step" (as in a ladder) is "staip," and the homophone of "twisted" is "twistid."

What is the homophone for a step of a ladder and twisted?

The homophone for "step of a ladder" and "twisted" is "rung".

What is the homophone for the step of a ladder?

The homophone for the step of a ladder is "stair."

Related questions

What is homophone the step of a ladder twisted?

Rung on a ladder and wrung for twisted.

What is the homophone for the step of a ladder twisted?

Rung on a ladder and wrung for twisted.

What is the homophone fot the step of a ladder and twisted?

The homophone for "step of a ladder" and "twisted" is "rung."

What is the homophone of the step of a ladder and twisted?

The homophone of "step" (as in a ladder) is "staip," and the homophone of "twisted" is "twistid."

What is the homophone for a step of a ladder and twisted?

The homophone for "step of a ladder" and "twisted" is "rung".

What general shape does this fragment of DNA resemble?

The DNA molecules resembles a twisted step ladder

What was Watson and cricks name for twisted-ladder of DNA?

Watson and Crick's Name for the twisted ladder of DNA

Nucleotides are found were on the DNA twisted ladder?

Nucleotides are found on the DNA twisted ladder as segments of the uprights and rungs.

Why the DNA molecule is compared with a twisted ladder?

the whole DNA strand looks like a twisted ladder. the molecules are on the strand.

What does a DNA nucleotide look like?

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

What is the shap of DNA?

double helix... its a ladder twisted

What does the double helix resemble?

a ladder being twisted

Trending Questions

What word means hard to understand? What is mabagal in English? Does Sean Forbes sign or Speak? How do you say Kassidy in French? How do you say how in abaluya language? Is under a preposition? How do you use the main word without the suffix reflect in a sentace? What are some other french speaking countries other that France? How do you spell Lutz in plural form? What describes the correct usage for a colon? How many syllables does tribe have? Is loafs a plural noun or common noun? What is the object of the preposition in the following sentence Lets meet Naomi and Sam at ten oclock.? Which Canadian province has the largest Chinese population? What is the medical terminology combining form meaning metatarsal? How do you spell the Spanish name José? How many languages can Gloria Estefan speak? How do you use the word pledge in a sentence? What did the whalers use? Is humbug a nouns?

Still have questions?

imp

Previously Viewed

What are the homophones for the step of a ladder and twisted?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.