0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What base sequence would be produced through DNA replication?
DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.
What situation would most directly affect future generations naturally produced by a maple tree?
Ultraviolent radiation changes the DNA sequence within the gametes of some flowers of the tree
Why is point mutation dangerous?
A frame shift mutation destroys the correct sequence of amino acids from the point of the mutation. The protein produced by a frame shift mutation would more than likely be nonfunctional.
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
one amino acid in the sequence would change
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What amino acid would be produced if transcription took place from the DNA sequence CAT?
g
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is a nth term in a sequence?
Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!
Why the addition of an extra base in a DNA sequence would change the message carried by a DNA molecule?
It could change the type of protein that would be produced hence change the structure and function of that protein.
What base sequence would be produced through DNA replication?
DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.
Explain why the addition of an extra base in a DNA sequence would change the message carried by a DNA molecule?
It could change the type of protein that would be produced hence change the structure and function of that protein.
What is the equation for finding the nth term of a nonlinear sequence?
There is no set equation for finding the nth term of a non- linear sequence. You have to go through a procedure to find the equation suitable for your given sequence. You would have to post the equation itself or re phrase your question for the answer.
What Substances produced in a cell an exported outside of the cell would pass through the what?
HeySubstance produced in a cell and expored outside of the cell would pass through the ENDOPLASMIC RETICULUM AND GOLGI APPARATUShope u like my answer:D
What situation would most directly affect future generations naturally produced by a maple tree?
Ultraviolent radiation changes the DNA sequence within the gametes of some flowers of the tree
