0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
Is the goal of DNA fingerprinting to identify the DNA sequence of every gene?
false it is to show that no one person can have the same fingerprint as another except twins
Which best describes how scientists the human gene that makes insulin?
They figured out the DNA sequence from the amino acid sequence
Why is it important to know a gene sequence?
what is a practical or clinical use of knowing the base sequence of a gene
What makes alleles of the same gene different from each other?
A gene consists of a specific sequence of bases; variations in that sequence make for a different gene.
Information can not be obtained from the sequence of a gene?
Whether the gene is methylated.
What has been used to identify the DNA sequence of every human gene?
The Human Genome Project.
What was the overall goal of the Human Genome Project?
To identify every human gene.<==== nova net answer.
What has been the human goal of the human genome projects?
to identify every human gene
Is the goal of DNA fingerprinting to identify the DNA sequence of every gene?
false it is to show that no one person can have the same fingerprint as another except twins
What is the human genome project an attempt to do?
The Human Genome Project was the effort to identify the 20,000-25,000 genes in human DNA. Once they had been identified they sequenced the 3 billion chemical base pairs that are present in human DNA, and stored this information in databases. This was a 13-year project that was completed in 2003. The Human Genome Project allowed scientists to better pinpoint genetic diseases and will help to find cures for these disorders.
Which best describes how scientists the human gene that makes insulin?
They figured out the DNA sequence from the amino acid sequence
What tags should be used to retrieve information from a database about a DNA segment of a human gene that codes for a specific protein?
Nucleotide sequence, human, hemoglobin
Which gene in c elegans encodes a protein similar in sequence to human elastase?
gene ID: 182375 on ncbi.nlm.gov/entrez
Which best describes how scientists found the human gene that makes insulin?
They figured out the DNA sequence from the amino acid sequence
What is the effects of mutation?
A mutation is a permenent in DNA sequence of a gene,mutation in a gene's DNA sequence can alterthe aminoacid sequence of the protein encodedby the gene.
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
A mutation is a change in a?
gene sequence
