0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
What name is assigned to augwhich stands for methionine in which all mRNA molecules start?
The start codon. The codon AUG is generally referred as the start codon because the translation of mRNA begins on AUG.
What codon must every mRNA begin with?
They all begin with AUG, which is the start codon.
What is the difference between a nonsense mutation and a missense mutation?
Missense mutation: changes one sense codon to another, resulting in incorporation of amino acid.Nonsense mutation: changes a sense codon into a stop (or nonsense) codon, resulting in premature termination.
What is the term for a 3-nucleotide sequence on mRNA that codes for an amino acid?
the three nucleotides on a mRNA that codes for a amino acid is called a codon
What is non sense codon?
A nonsense codon is nucleotide triplet that does not code for an amino acid, but rather it promotes the stop of transcription. These codons include UAA, UGA, and UGA.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Is a stop codon the same as a regulator?
In a sense. It regulates the length and the sequence of a polypeptide chain by terminating it's synthesis.
What is a Complimentary codon?
A complimentary codon is one that pairs with another codon according to the base pairing rule. For example, the DNA codon ATG is complimentary to the mRNA codon UAC.
Complementary of a codon?
anti-codon.
What name is assigned to augwhich stands for methionine in which all mRNA molecules start?
The start codon. The codon AUG is generally referred as the start codon because the translation of mRNA begins on AUG.
What is codon recognition?
Short Answer is: for every triplet codon there is a recognizable anti-triplet codon.
What is the three base sequence in mRNA?
called CODON.
The codon GAU is for?
GAU is the codon.
What is the codon for trytophan?
The codon for trytophan is UGG.
What codon must every mRNA begin with?
They all begin with AUG, which is the start codon.
What is the difference between a nonsense mutation and a missense mutation?
Missense mutation: changes one sense codon to another, resulting in incorporation of amino acid.Nonsense mutation: changes a sense codon into a stop (or nonsense) codon, resulting in premature termination.
