0
What else can I help you with?
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
What name is assigned to augwhich stands for methionine in which all mRNA molecules start?
The start codon. The codon AUG is generally referred as the start codon because the translation of mRNA begins on AUG.
What is the codon that initiates transcription?
The start codon is AUG, or Methionine(Met)
What is the term for a 3-nucleotide sequence on mRNA that codes for an amino acid?
the three nucleotides on a mRNA that codes for a amino acid is called a codon
What is the stop codon in most molecules of mRNA?
stop codon on mRNA
What is non sense codon?
A nonsense codon, also known as a stop codon, is a three-nucleotide sequence in mRNA that signals the termination of translation. When a ribosome encounters a stop codon, protein synthesis stops, and the incomplete polypeptide chain is released. There are three stop codons: UAG, UAA, and UGA.
Is a stop codon the same as a regulator?
In a sense. It regulates the length and the sequence of a polypeptide chain by terminating it's synthesis.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
What is the codon for trytophan?
The codon for trytophan is UGG.
Complementary of a codon?
anti-codon.
What is a Complimentary codon?
A complimentary codon is one that pairs with another codon according to the base pairing rule. For example, the DNA codon ATG is complimentary to the mRNA codon UAC.
What codon is typically used as the start codon in protein synthesis?
The codon typically used as the start codon in protein synthesis is AUG.
What name is assigned to augwhich stands for methionine in which all mRNA molecules start?
The start codon. The codon AUG is generally referred as the start codon because the translation of mRNA begins on AUG.
What is the starter codon?
Usual start codon is AUG
What is the definition of an codon?
A codon is a unit of genetic code
What is the codon that initiates transcription?
The start codon is AUG, or Methionine(Met)
What is the name of the process where RNA codon is read and the tRNA anti-codon brings amino acids to the codon?
Transcription
