0
What else can I help you with?
What is the codon for trytophan?
The codon for trytophan is UGG.
What codon is typically used as the start codon in protein synthesis?
The codon typically used as the start codon in protein synthesis is AUG.
What is mrna codon for T A C?
The mRNA codon for TAC is AUG. This codon codes for the amino acid methionine and also serves as the start codon for protein synthesis.
The codon GAU is for?
GAU is the codon.
Is ATG a start codon in genetic coding?
No, ATG is not a start codon in genetic coding. The start codon is typically AUG.
What is codon and sense codon?
A codon is a sequence of three nucleotides in DNA or RNA that codes for a specific amino acid. A sense codon is a codon that specifies one of the 20 standard amino acids in protein synthesis.
What are some types of genetic mutations?
Mis sense: change of a base resulting in a different amino acid Non sense: change of a base resulting in a stop codon Addition: extra base is added Deletion: a base is deleted Substituion: a base is replaced.
How do you say that is non sense?
that is non sense
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Is a stop codon the same as a regulator?
In a sense. It regulates the length and the sequence of a polypeptide chain by terminating it's synthesis.
What is the codon for trytophan?
The codon for trytophan is UGG.
What is the sense of Nonsense?
a sense which is non
What is a Complimentary codon?
A complimentary codon is one that pairs with another codon according to the base pairing rule. For example, the DNA codon ATG is complimentary to the mRNA codon UAC.
Complementary of a codon?
anti-codon.
What codon is typically used as the start codon in protein synthesis?
The codon typically used as the start codon in protein synthesis is AUG.
What name is assigned to augwhich stands for methionine in which all mRNA molecules start?
The start codon. The codon AUG is generally referred as the start codon because the translation of mRNA begins on AUG.
What are sense and anti sense genetic mutations?
A sense mutation happens among the bases that code for actual amino acids: The sense. One variation here could be disastrous, or five could be a beneficial mutation. Sickle cell trait varies bu only one amino acid on the B protein of hemoglobin and can be life threatening in homozygous condition, or beneficial in heterozygous condition. Most mutations fall among the non-sense portions of the genome and are neutral. And now the Techno Fun Portion: the anti sense [non-sense] mutation is Stdby::
